IthaID: 2070
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs7599488 | HGVS Name: | NG_011968.1:g.67287G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CAAAGAAGTTAGTCTCAGCCACCTG [C/T] GCATCCTCAATGCAAAAAGCTAAGT (Strand: +)
Comments: Associated with HbF levels is a subset of Cooperative Study of Sickle Cell Disease (CSSCD) participants. Associated with HbF level in Saudi W (benin haplotype) patients, but was not replicated in Saudi E (AI haplotype), Indian (AI haplotype) and a different subset of African-American (CSSD) patients with sickle cell anaemia (SCA, βS homozygotes). Associated with the hydroxyurea-induced increment in children with sickle cell disease (SCD), but not baseline or maximum HbF levels. The association was not replicated in a pediatric cohort of SCA from Brazil. Associated with HbF in Chinese Zhuang β-thalassemia intermedia patients.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Hb F response to hydroxyurea |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_011968.1 |
| Locus Location: | 67287 |
| Size: | 1 bp |
| Located at: | BCL11A |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010 PubMed
- Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
- Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015 PubMed
- Lai Y, Chen Y, Chen B, Zheng H, Yi S, Li G, Wei H, He S, Zheng C, Genetic Variants at BCL11A and HBS1L-MYB loci Influence Hb F Levels in Chinese Zhuang β-Thalassemia Intermedia Patients., Hemoglobin, 40(6), 405-410, 2016 PubMed
- Sales RR, Belisário AR, Faria G, Mendes F, Luizon MR, Viana MB, Functional polymorphisms of BCL11A and HBS1L-MYB genes affect both fetal hemoglobin level and clinical outcomes in a cohort of children with sickle cell anemia., Ann Hematol, 99(7), 1453-1463, 2020 PubMed