IthaID: 2093
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs6545816 | HGVS Name: | NG_011968.1:g.70773T>G |
Context nucleotide sequence:
CCCTTATTTATGAGCAGCAGAATGT [A/C] AAAAGCAAGAGGCTTAATTTTAATG (Strand: +)
Also known as:
Comments: SNP associated with variation in HbF/F-cells, as well as disease severity in Thais with β-thalassemia and/or HbE trait. Associated with platelet count in a sickle cell anaemia cohort from Nigeria.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] F-cell numbers Abnormal platelet count [HP:0011873] |
Location
Chromosome: | 2 |
---|---|
Locus: | NG_011968.1 |
Locus Location: | 70773 |
Size: | 1 bp |
Located at: | BCL11A |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Thai, Thai-Chinese, Nigerian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Sedgewick AE, Timofeev N, Sebastiani P, So JC, Ma ES, Chan LC, Fucharoen G, Fucharoen S, Barbosa CG, Vardarajan BN, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, BCL11A is a major HbF quantitative trait locus in three different populations with beta-hemoglobinopathies., Blood Cells Mol. Dis. , 41(3), 255-8, 2008 PubMed
- Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
- Adeyemo TA, Ojewunmi OO, Oyetunji IA, Rooks H, Rees DC, Akinsulie AO, Akanmu AS, Thein SL, Menzel S, A survey of genetic fetal-haemoglobin modifiers in Nigerian patients with sickle cell anaemia., PLoS ONE , 13(6), e0197927, 2018 PubMed
Created on 2013-09-11 17:44:45,
Last reviewed on 2019-07-02 14:41:21 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-09-11 17:44:45 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2015-05-11 16:06:21 | The IthaGenes Curation Team | Reviewed. Common name and context sequence corrected. |
4 | 2016-05-17 18:07:02 | The IthaGenes Curation Team | Reviewed. |
5 | 2016-09-27 15:31:30 | The IthaGenes Curation Team | Reviewed. Mutation comment section updated. |
6 | 2019-07-02 14:41:21 | The IthaGenes Curation Team | Reviewed. Reference, Clinical phenotype, Ethnic origin and Comment added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-09-05 13:01:20