IthaID: 2093
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs6545816 | HGVS Name: | NG_011968.1:g.70773T>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCCTTATTTATGAGCAGCAGAATGT [A/C] AAAAGCAAGAGGCTTAATTTTAATG (Strand: +)
Comments: SNP associated with variation in HbF/F-cells, as well as disease severity in Thais with β-thalassemia and/or HbE trait. Associated with platelet count in a sickle cell anaemia cohort from Nigeria.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] F-cell numbers Abnormal platelet count [HP:0011873] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_011968.1 |
| Locus Location: | 70773 |
| Size: | 1 bp |
| Located at: | BCL11A |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Thai, Thai-Chinese, Nigerian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Sedgewick AE, Timofeev N, Sebastiani P, So JC, Ma ES, Chan LC, Fucharoen G, Fucharoen S, Barbosa CG, Vardarajan BN, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, BCL11A is a major HbF quantitative trait locus in three different populations with beta-hemoglobinopathies., Blood Cells Mol. Dis. , 41(3), 255-8, 2008 PubMed
- Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010 PubMed
- Adeyemo TA, Ojewunmi OO, Oyetunji IA, Rooks H, Rees DC, Akinsulie AO, Akanmu AS, Thein SL, Menzel S, A survey of genetic fetal-haemoglobin modifiers in Nigerian patients with sickle cell anaemia., PLoS ONE , 13(6), e0197927, 2018 PubMed
Created on 2013-09-11 17:44:45,
Last reviewed on 2019-07-02 14:41:21 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.