You are here:  
  1. Home
  2. Databases & Tools
  3. IthaGenes

IthaID: 2105



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs9376090 HGVS Name: NC_000006.12:g.135090090T>C

Context nucleotide sequence:
AGCTAAGTCTAGCTGAGTGTTAGCC [C/T] GGGGGATACTGCCAGGAACAAATGA (Strand: +)

Also known as:

Comments: SNP associated with HbF/F-cell variation in healthy Northern European (TwinUK cohort). It associated with HbF levels in individuals from China with β-thalassaemia and from Cameroon with sickle cell disease. SNP associated with lower levels of hematocrit in the Kore Association Resource (KARE) project of the Korean Genome Epidemiology Study (KoGES; n=8842). The association was replicated in healthy samples from the Cardio Vascular Disease Association Study (CAVAS) of KoGES (n=3667).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome: 6
Locus: NT_025741.15
Locus Location: N/A
Size: 1 bp
Located at: HBS1L-MYB
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Northern European, Chinese, Cameroonian, Korean
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Thein SL, Menzel S, Peng X, Best S, Jiang J, Close J, Silver N, Gerovasilli A, Ping C, Yamaguchi M, Wahlberg K, Ulug P, Spector TD, Garner C, Matsuda F, Farrall M, Lathrop M, Intergenic variants of HBS1L-MYB are responsible for a major quantitative trait locus on chromosome 6q23 influencing fetal hemoglobin levels in adults., Proc. Natl. Acad. Sci. U.S.A. , 104(27), 11346-51, 2007 PubMed
  2. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011 PubMed
  3. Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014 PubMed
  4. Kim YK, Oh JH, Kim YJ, Hwang MY, Moon S, Low SK, Takahashi A, Matsuda K, Kubo M, Lee J, Kim BJ, Influence of Genetic Variants in EGF and Other Genes on Hematological Traits in Korean Populations by a Genome-Wide Approach., Biomed Res Int , 2015(0), 914965, 2015 PubMed
Created on 2013-09-16 15:13:52, Last reviewed on 2019-12-05 11:56:00 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45