IthaID: 2119



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs12103880 HGVS Name: NC_000017.11:g.9795025G>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCAGTAATATTCCTGGAACTCGTAG [A/G] TAAAGGATGCAAGGACTAAACAAGG (Strand: +)

Comments: SNP associated with variation in F-cell number in the male subjects of a sickle cell disease cohort acquired from the Silent Infarct Transfusion (SIT) Trial. It was nominally associated with HbF response to hydroxyurea in pediatric patients with sickle cell disease.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Hb F response to hydroxyurea

Location

Chromosome: 17
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: DHRS7C-GLP2R
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
  2. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
  3. Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014 PubMed
Created on 2013-09-19 12:35:06, Last reviewed on 2016-05-25 12:09:31 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.