IthaID: 2131
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 270 (TCG>TAG) | HGVS Name: | NG_013087.1:g.6783C>A |
Context nucleotide sequence:
GCGCCATCCAAGCGAGGCCGACGTT [C/A] GTGGGCGCGCAAGAGGCAGGCAGCG (Strand: -)
Also known as:
Comments: Protein change: S270X. KLF1 haploinsufficiency due to S270X non-sense mutation is associated with significant age-related variation of HbF levels. In a Sardinia family, high levels of HbF were present only in compound heterozygotes for the S270X nonsense and K332Q missense mutations. Associated with borderline HbA2.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | Increased expression for Aγ or Gγ |
Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
Chromosome: | 19 |
---|---|
Locus: | NG_013087.1 |
Locus Location: | 6783 |
Size: | 1 bp |
Located at: | KLF1 |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Nonsense codon (Translation), Insertion/Deletion of codons (Protein Structure) |
Ethnic Origin: | Sardinians |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Satta S, Perseu L, Moi P, Asunis I, Cabriolu A, Maccioni L, Demartis FR, Manunza L, Cao A, Galanello R, Compound heterozygosity for KLF1 mutations associated with remarkable increase of fetal hemoglobin and red cell protoporphyrin., Haematologica , 96(5), 767-70, 2011 PubMed
- Perseu L, Satta S, Moi P, Demartis FR, Manunza L, Sollaino MC, Barella S, Cao A, Galanello R, KLF1 gene mutations cause borderline HbA(2)., Blood , 118(16), 4454-8, 2011 PubMed
- Satta S, Perseu L, Maccioni L, Giagu N, Galanello R, Delayed fetal hemoglobin switching in subjects with KLF1 gene mutation., Blood Cells Mol. Dis. , 48(1), 22-4, 2012 PubMed
Created on 2013-09-24 16:45:55,
Last reviewed on 2016-09-12 17:14:09 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-09-24 16:45:55 | The IthaGenes Curation Team | Created |
2 | 2013-12-20 09:29:52 | The IthaGenes Curation Team | Reviewed. |
3 | 2014-03-20 10:41:43 | The IthaGenes Curation Team | Reviewed. |
4 | 2015-06-30 17:06:56 | The IthaGenes Curation Team | Reviewed. Comment and reference added. |
5 | 2016-09-12 17:14:09 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02