IthaID: 2276
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs944725 | HGVS Name: | NG_011470.1:g.22985G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTGATATTATCCTGCAACAAATGA [C/T] TCCCCAACAAAAAGATGGCCTAGGA (Strand: +)
Comments: SNP associated with the HbF response (increase) to hydroxyurea treatment in sickle cell anaemia patients of African-American origin (MSH cohort) [PMID: 17299377] and in Hb S/β-thal patients of Hellenic (Greek) origin in two independent studies [PMID: 31039620].
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F response to hydroxyurea |
Location
| Chromosome: | 17 |
|---|---|
| Locus: | NG_011470.1 |
| Locus Location: | 22985 |
| Size: | 1 bp |
| Located at: | NOS2 |
| Specific Location: | Intron 6 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American, Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Ma Q, Wyszynski DF, Farrell JJ, Kutlar A, Farrer LA, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyurea., Pharmacogenomics J. , 7(6), 386-94, 2007 PubMed
- Chalikiopoulou C, Tavianatou AG, Sgourou A, Kourakli A, Kelepouri D, Chrysanthakopoulou M, Kanelaki VK, Mourdoukoutas E, Siamoglou S, John A, Symeonidis A, Ali BR, Katsila T, Papachatzopoulou A, Patrinos GP, Genomic variants in the ASS1 gene, involved in the nitric oxide biosynthesis and signaling pathway, predict hydroxyurea treatment efficacy in compound sickle cell disease/β-thalassemia patients., Pharmacogenomics , 17(4), 393-403, 2016 PubMed
- Kolliopoulou A, Siamoglou S, John A, Sgourou A, Kourakli A, Symeonidis A, Vlachaki E, Chalkia P, Theodoridou S, Ali BR, Katsila T, Patrinos GP, Papachatzopoulou A, Role of Genomic Biomarkers in Increasing Fetal Hemoglobin Levels Upon Hydroxyurea Therapy and in β-Thalassemia Intermedia: A Validation Cohort Study., Hemoglobin, 2019 PubMed
Created on 2013-10-07 15:50:44,
Last reviewed on 2019-05-28 12:40:08 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.