IthaID: 2286
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -473 (A>G) | HGVS Name: | NT_010393.16:g.31478982A>G |
Context nucleotide sequence:
TAGGGCTCAGTAAACGTCAATTTCCATAGCATTTCGAGCCTGGATACTGA [A/G] ATATGGGGCAAAAAGCAGGAACATGCCCCTGGTTTGGCTCTTGCCTTCTTGCATTTCCTG (Strand: +)
Also known as: 11943(A>G), c.-201A, rs4499252
Comments: Apparently neutral polymorphism in the promoter region of AHSP (alpha-haemoglobin stabilizing protein). A case-control study revealed a higher frequency of the A allele in β-thalassemia patients in the Iraqi population.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NT_010393.16 |
| Locus Location: | 31478982 |
| Size: | 1 bp |
| Located at: | AHSP |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian, Iraqi |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- dos Santos CO, Zhou S, Secolin R, Wang X, Cunha AF, Higgs DR, Kwiatkowski JL, Thein SL, Gallagher PG, Costa FF, Weiss MJ, Population analysis of the alpha hemoglobin stabilizing protein (AHSP) gene identifies sequence variants that alter expression and function., Am. J. Hematol. , 83(2), 103-8, 2008 PubMed
- Adnan Khalaf M, Hasan ABQ, Qassim Mohammed H, Hussein Ewaid S, Alpha-Hemoglobin Stabilizing Protein Gene Polymorphism (rs4499252 A/G) and its Association with Beta-Thalassemia Major in Iraqi Patients., Arch Razi Inst, 77(3), 1033-1039, 2022 PubMed
Created on 2013-10-16 15:59:50,
Last reviewed on 2023-01-11 14:04:46 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2013-10-16 15:59:50 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-17 10:28:14 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2020-09-28 16:46:11 | The IthaGenes Curation Team | Reviewed. Inheritance corrected. |
| 4 | 2023-01-11 14:04:46 | The IthaGenes Curation Team | Reviewed. Reference added. Comment updated. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02