IthaID: 2291
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 56 GTG > GGG | HGVS Name: | NT_010393.16:g.31479870T>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACATGGTGACTGTGGTGGAGGACTGGATGAACTTCTACATCAACTATTACAGGCAGCAGG [T/G] GACAGGGGAGCCCCAAGAGCGAGACAAGGCTCTGCAGGAGCTTCGGCAAG (Strand: +)
Comments: The AHSP structural variant produced by the G allele shows decreased interaction with alpha globin and is thus predicted as an aggravating modifier of the thalassemias, in particular of beta-thalassaemia. This assumption is supported by the observation of moderate thalassaemia in a homozygote for AHSP(V56G) during his first year of life.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | Precipitation for α1 or α2 |
| Associated Phenotypes: | Anaemia [HP:0001903] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NT_010393.16 |
| Locus Location: | 31479870 |
| Size: | 1 bp |
| Located at: | AHSP |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian, South-east Asian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Wang Z, Yu W, Li Y, Shang X, Zhang X, Xiong F, Xu X, Analysis of alpha-hemoglobin-stabilizing protein (AHSP) gene as a genetic modifier to the phenotype of beta-thalassemia in Southern China., Blood Cells Mol. Dis. , 45(2), 128-32, 2010 PubMed
- Brillet T, Baudin-Creuza V, Vasseur C, Domingues-Hamdi E, Kiger L, Wajcman H, Pissard S, Marden MC, Alpha-hemoglobin stabilizing protein (AHSP), a kinetic scheme of the action of a human mutant, AHSPV56G., J. Biol. Chem. , 285(23), 17986-92, 2010 PubMed
- Wajcman H, Vasseur C, Pissard S, Baudin-Creuza V, α-Hemoglobin stabilizing protein: a modulating factor in thalassemias?, Hemoglobin , 35(5), 463-8, 2011 PubMed
Created on 2013-10-17 11:14:45,
Last reviewed on 2019-07-04 12:04:09 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.