IthaID: 2291



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: CD 56 GTG > GGG HGVS Name: NT_010393.16:g.31479870T>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ACATGGTGACTGTGGTGGAGGACTGGATGAACTTCTACATCAACTATTACAGGCAGCAGG [T/G] GACAGGGGAGCCCCAAGAGCGAGACAAGGCTCTGCAGGAGCTTCGGCAAG (Strand: +)

Comments: The AHSP structural variant produced by the G allele shows decreased interaction with alpha globin and is thus predicted as an aggravating modifier of the thalassemias, in particular of beta-thalassaemia. This assumption is supported by the observation of moderate thalassaemia in a homozygote for AHSP(V56G) during his first year of life.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Precipitation for α1 or α2
Associated Phenotypes: Anaemia [HP:0001903]

Location

Chromosome: 16
Locus: NT_010393.16
Locus Location: 31479870
Size: 1 bp
Located at: AHSP
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian, South-east Asian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Wang Z, Yu W, Li Y, Shang X, Zhang X, Xiong F, Xu X, Analysis of alpha-hemoglobin-stabilizing protein (AHSP) gene as a genetic modifier to the phenotype of beta-thalassemia in Southern China., Blood Cells Mol. Dis. , 45(2), 128-32, 2010 PubMed
  2. Brillet T, Baudin-Creuza V, Vasseur C, Domingues-Hamdi E, Kiger L, Wajcman H, Pissard S, Marden MC, Alpha-hemoglobin stabilizing protein (AHSP), a kinetic scheme of the action of a human mutant, AHSPV56G., J. Biol. Chem. , 285(23), 17986-92, 2010 PubMed
  3. Wajcman H, Vasseur C, Pissard S, Baudin-Creuza V, α-Hemoglobin stabilizing protein: a modulating factor in thalassemias?, Hemoglobin , 35(5), 463-8, 2011 PubMed
Created on 2013-10-17 11:14:45, Last reviewed on 2019-07-04 12:04:09 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.