IthaID: 2291
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 56 GTG > GGG | HGVS Name: | NT_010393.16:g.31479870T>G |
Context nucleotide sequence:
ACATGGTGACTGTGGTGGAGGACTGGATGAACTTCTACATCAACTATTACAGGCAGCAGG [T/G] GACAGGGGAGCCCCAAGAGCGAGACAAGGCTCTGCAGGAGCTTCGGCAAG (Strand: +)
Also known as: V56G, rs186590045
Comments: The AHSP structural variant produced by the G allele shows decreased interaction with alpha globin and is thus predicted as an aggravating modifier of the thalassemias, in particular of beta-thalassaemia. This assumption is supported by the observation of moderate thalassaemia in a homozygote for AHSP(V56G) during his first year of life.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | Precipitation for α1 or α2 |
| Associated Phenotypes: | Anaemia [HP:0001903] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NT_010393.16 |
| Locus Location: | 31479870 |
| Size: | 1 bp |
| Located at: | AHSP |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian, South-east Asian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Wang Z, Yu W, Li Y, Shang X, Zhang X, Xiong F, Xu X, Analysis of alpha-hemoglobin-stabilizing protein (AHSP) gene as a genetic modifier to the phenotype of beta-thalassemia in Southern China., Blood Cells Mol. Dis. , 45(2), 128-32, 2010 PubMed
- Brillet T, Baudin-Creuza V, Vasseur C, Domingues-Hamdi E, Kiger L, Wajcman H, Pissard S, Marden MC, Alpha-hemoglobin stabilizing protein (AHSP), a kinetic scheme of the action of a human mutant, AHSPV56G., J. Biol. Chem. , 285(23), 17986-92, 2010 PubMed
- Wajcman H, Vasseur C, Pissard S, Baudin-Creuza V, α-Hemoglobin stabilizing protein: a modulating factor in thalassemias?, Hemoglobin , 35(5), 463-8, 2011 PubMed
Created on 2013-10-17 11:14:45,
Last reviewed on 2019-07-04 12:04:09 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2013-10-17 11:14:45 | The IthaGenes Curation Team | Created |
| 2 | 2013-11-01 13:47:04 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2019-07-04 12:04:09 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45