IthaID: 2294



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: CD 327 (ACC>AGC) HGVS Name: NG_013087.1:g.7210C>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AGATTCGCGCGCTCGGACGAGCTGA [C/G] CCGCCACTACCGGAAACACACGGGG (Strand: -)

Comments: Protein Change: T327S. Cause borderline HbA2

External Links

No available links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for δ
Associated Phenotypes: N/A

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 7210
Size: 1 bp
Located at: KLF1
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: Sardinians
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Perseu L, Satta S, Moi P, Demartis FR, Manunza L, Sollaino MC, Barella S, Cao A, Galanello R, KLF1 gene mutations cause borderline HbA(2)., Blood , 118(16), 4454-8, 2011 PubMed
Created on 2013-12-20 13:59:54, Last reviewed on 2014-03-20 10:46:07 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.