IthaID: 2296

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: CD 319 (+1bp): (+G) HGVS Name: NG_013087.1:g.7184dupG

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CTGCACGTGGGAAGGCTGCGGCTGG [-/G] AGATTCGCGCGCTCGGACGAGCTGA (Strand: -)

Comments: Protein change: Arg319GlufsX34. Cause borderline HbA2

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for δ
Associated Phenotypes: N/A

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 7184
Size: 1 bp
Located at: KLF1
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Sardinians
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Perseu L, Satta S, Moi P, Demartis FR, Manunza L, Sollaino MC, Barella S, Cao A, Galanello R, KLF1 gene mutations cause borderline HbA(2)., Blood , 118(16), 4454-8, 2011
Created on 2013-12-20 14:34:46, Last reviewed on 2014-03-20 11:05:01 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.