Loading... Please wait!
Quick filtering
Showing all Point-Mutations (Show All):
IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
---|---|---|---|---|---|---|---|---|
3720 | CD 1/2 (+TG) | N/A | HBA2:c.6_7insTG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33781 |
3714 | CD 15/16 (+T) | N/A | HBA2:c.48_49insT | α2 | Causative | α-thalassaemia | NG_000006.1 | 33823 |
2207 | CD 21/22 +T | N/A | HBA2:c.66dupT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33841 |
516 | CD 37 +GAA [+Glu] | Hb Catonsville | HBA1:c.114_115insGAA | HBA2:c.114_115insGAA | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34006, 37810 |
2217 | CD 51/52 +G | N/A | HBA2:c.156_157insG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34048 |
3079 | CD 55 +T | N/A | HBA2:c.168dup | α2 | Causative | α-thalassaemia | NG_000006.1 | 34060 |
3705 | CD 72 (+C) | N/A | HBA2:c.217dup | α2 | Causative | α-thalassaemia | NG_000006.1 | 34109 |
3632 | CD 76/77 (+T) | N/A | HBB:c.231_232insT | α2 | Causative | α-thalassaemia | NG_000006.1 | 34123 |
644 | CD 87 +9 bp [+Ser-Asp-Leu] | Hb Neuilly-sur-Marne | HBA1:c.253_261dup | HBA2:c.253_261dup | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34154, 37949 |
3080 | CD 94 (+21 bp duplication) | Hb SKMC | HBA2:c.283_300+3dup | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34175 |
3365 | IVS II-119 (-G) (+CTCGGCCC) | N/A | HBA2:c.301-24delGinsCTCGGCCC | α2 | Neutral | N/A | NG_000006.1 | 34311 |
721 | CD 116-117 +15 bp [+His-Leu-Pro-Ala-Glu] | Hb Zaïre | HBA1:c.337_351dup | HBA2:c.337_351dup | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34371, 38182 |
2527 | CD 114 (+CC) | N/A | HBA2:c.344_345dup | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34378 |
3862 | CD 125 (+C) | N/A | HBA2:c.376dupC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34410 |
4085 | CD 132 (+T) | Hb Balkh | HBA2:c.398dup | α2 | Causative | α-chain variant | NG_000006.1 | 34432 |
2352 | CD 2/3 +CTG [+Leu] | Hb Pittsburgh | HBA1:c.9_10insCTG | α1 | Causative | α-chain variant | NG_000006.1 | 37588 |
2205 | CD 20 +T | N/A | HBA1:c.62_63insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37641 |
3403 | CD 39 +A | N/A | HBA2:c.118_119insA | α2 | Causative | α-thalassaemia | NG_000006.1 | 37814 |
2468 | CD 44 +C | N/A | HBA1:c.134_135insC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37830 |
2529 | CD 50 +GGAGCC | Hb Bakersfield | HBA1:c.151_152insGGAGCC | α1 | Causative | α-chain variant | NG_000006.1 | 37847 |
3442 | CD 51-58 (+24 bp) | Hb Choisy | HBA1:c.157_180dupTCTGCCCAGGTTAAGGGCCACGGC | α1 | Causative | α-chain variant | NG_000006.1 | 37853 |
3075 | CD 56/57 (+24bp) (HBA1:p.Lys57_Gly58insSerHisGlySerAlaGlnValLys , Hb KSVGH) | Hb Kaohsiung Veterans General Hospital | HBA1:c.171_172insAGCCACGGCTCTGCCCAAGTTAGG | α1 | Causative | α-chain variant | NG_000006.1 | 37868 |
597 | CD 68 +GCGCTGACCAAC [+Ala-Leu-Thr-Asn] | Hb Esch | HBA1:c.207_208insGCGCTGACCAAC | α1 | Causative | α-chain variant | NG_000006.1 | 37904 |
390 | CD 93-99 (+21 bp) | N/A | HBA1:c.280_300ins21 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37976 |
2539 | IVS II-3 (+21bp) | Hb SKMC | HBA1:c.283_300+3dup | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37979 |
723 | CD 118-119 +9 bp [+Glu-Phe-Thr] (Hb Dakar) | Hb Grady | HBA1:c.349_357dup | α1 | Causative | α-chain variant | NG_000006.1 | 38194 |
3281 | CD 130 (+T) | Hb Sichuan | HBA1:c.393_394insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38238 |
416 | CD 131 (+T) >175aa | Hb Pak Num Po | HBA1:c.396dup | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38241 |
3739 | TTS +23 (+T) | N/A | HBA1:c.*134_*135insT | α1 | Causative | α-thalassaemia | NG_000006.1 | 38408 |
3573 | rs3834466 | N/A | NG_000007.3:g.27282dup | β | Neutral | N/A | NG_000007.3 | 27282 |
3943 | -200 (+CC) | N/A | HBG2:c.-253_-254dup | Gγ | Causative | HPFH | NG_000007.3 | 42634 |
1556 | -200 +C (Tunisian non-deletional HPFH) | N/A | HBG2:c.-253dup | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42635 |
3865 | -219 (+AGCA) | N/A | HBG1:c.-272_-275dup | Aγ | Causative | HPFH | NG_000007.3 | 47537 |
2563 | IVS I-1 (27 bp insertion) | N/A | HBD:c.92+83_84ins27 | δ | Causative | δ-thalassaemia | NG_000007.3 | 63357 |
2575 | CD 58 +C | N/A | HBD:c.176_177insC | δ | Causative | δ-thalassaemia | NG_000007.3 | 63486 |
3237 | CD 59/60 (+GG) | N/A | HBD:c.180_181dup | δ | Causative | δ-thalassaemia | NG_000007.3 | 63490 |
1338 | CD 91 (+T) | N/A | HBD:c.275dupT | δ | Causative | δ-thalassaemia | NG_000007.3 | 63585 |
2521 | CD 110-111 +GT | N/A | HBD:c.333_334insGT | δ | Causative | δ-thalassaemia, δ-chain variant | NG_000007.3 | 64541 |
3234 | CD 113 (+TG) | N/A | HBD:c.341_342dupTG | δ | Causative | δ-thalassaemia | NG_000007.3 | 64549 |
33 | -22 to +23 (+45 bp duplication) | N/A | NG_000007.3:g.70573_70617dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70573 |
52 | CD 3 (+T) | N/A | HBB:c.11dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70605 |
2958 | CD 7/8 (+G) | N/A | HBB:c.24dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70618 |
2185 | CD 8/9 +AGAA | N/A | HBB:c.27_28insAGAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70620 |
62 | CD 8/9 (+G) | N/A | HBB:c.27dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
63 | CD 9 (+TA) | N/A | HBB:c.28_29insTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70622 |
64 | CD 9/10 (+T) | Hb Gaziantep | HBB:c.30dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70624 |
4108 | CD 10 GCC>GTC [Ala>Val] | N/A | HBB:c.31_32insT | β | Causative | β-thalassaemia | NG_000007.3 | 70625 |
68 | CD 14 (+T) | N/A | HBB:c.44dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
69 | CD 14/15 (+G) | N/A | HBB:c.45dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70639 |
71 | CD 15/16 (+G) | N/A | HBB:c.50dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
78 | CD 17 (+A) | N/A | HBB:c.53dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70647 |
81 | CD 20/21 (+G) | N/A | HBB:c.64dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
87 | CD 25/26 (+T) | N/A | HBB:c.78dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70672 |
90 | CD 26 (+T) | N/A | HBB:c.79_80insT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
92 | CD 27/28 (+C) | N/A | HBB:c.85dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
124 | IVS I [3' end] (+22bp) | N/A | NG_000007.3:g.70807_70828dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70807 |
125 | CD 30/31 +CGG [+Arg] | N/A | HBB:c.93_94insCGG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70817 |
144 | CD 40 (+86 bp) (HGSA) | N/A | HBB:c.123_208dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
145 | CD 40/41 (+T) | N/A | HBB:c.125dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70849 |
148 | CD 42/43 (+T) | N/A | HBB:c.129dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70853 |
149 | CD 42/43 (+G) | N/A | HBB:c.130dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
153 | CD 45 (+T) | N/A | HBB:c.138dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
154 | CD 45/46 (+A) | N/A | HBB:c.138_139insA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
2960 | CD 46/47 (+G) | N/A | HBB:c.142_142dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70866 |
155 | CD 47 (+A) | N/A | HBB:c.143dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
156 | CD 47/48 (+ATCT) | N/A | HBB:c.143_146dupATCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
161 | CD 53/54 (+G) | N/A | HBB:c.163dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70887 |
163 | CD 54/55 (+A) | N/A | HBB:c.166dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
166 | CD 56-60 (+14 bp) | N/A | HBB:c.170_183dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70894 |
167 | CD 58 (+C) | N/A | HBB:c.176dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70900 |
3944 | CD 64 (+G) | N/A | HBB:c.194dup | β | Causative | β-thalassaemia | NG_000007.3 | 70918 |
2525 | CD 68/69 (+AAAGTGCTC) | Hb Bronx | HBB:c.199_207dupAAAGTGCTC | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70923 |
1029 | CD 69 (+GCTCGG) | Hb Nishinomiya | HBB:c.204_209dupGCTCGG | β | Causative | β-chain variant | NG_000007.3 | 70928 |
176 | CD 71 (+T) | N/A | HBB:c.216dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70940 |
177 | CD 71/72 (+A) | N/A | HBB:c.217dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
2181 | CD 72/73 (+T) | N/A | HBB:c.219dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70943 |
1043 | CD 73-75 (-GATGGCCTG; + Ala-Arg-Cys-Gln) | Hb Montreal | HBB:c.220_228delinsGCTCGGTGCCAG | β | Causative | β-chain variant | NG_000007.3 | 70944 |
3299 | CD 77/78 (+C) | N/A | HBB:c.235dupC | β | Causative | β-thalassaemia | NG_000007.3 | 70959 |
187 | CD 84/85 (+C) | N/A | HBB:c.255dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70979 |
188 | CD 84-86 (+T) | N/A | HBB:c.258dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70982 |
189 | CD 88 (+T) | N/A | HBB:c.266dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
1118 | CD 94/95 +15 bp [+Glu-Leu-His-Cys-Asp] | Hb Fairfax | HBB:c.271_285dupGAGCTGCACTGTGAC | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70995 |
3057 | CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG) | N/A | HBB:c.272_295dup | β | Causative | β-thalassaemia | NG_000007.3 | 70996 |
1124 | CD 95/96 (+15 bp) | Hb Koriyama | HBB:c.274_288dup | β | Causative | β-chain variant | NG_000007.3 | 70998 |
194 | CD 91 (+T) | N/A | HBB:c.275dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
195 | CD 93/94 (+TG) | Hb Agnana | HBB:c.282_283dupTG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71006 |
196 | CD 95 (+A) | N/A | HBB:c.287dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71011 |
3888 | CD 97/98 (+GCAC) | N/A | HBB:c.291_294dup | β | Causative | β-thalassaemia | NG_000007.3 | 71015 |
2966 | CD 98/99 (+TG) | Hb Patagonia | HBB:c.296_297dup | β | Causative | β-chain variant | NG_000007.3 | 71020 |
198 | CD 100 (-CC,+TCTGAGAACTT) >158aa | N/A | HBB:c.301_302delCCinsTCTGAGAACTT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71025 |
2279 | CD 102 AAC>ATCAC | N/A | HBB:c.308insTC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71032 |
3796 | IVS II-716 (+T) | N/A | HBB:c.316-135dupT | β | Causative | β-thalassaemia | NG_000007.3 | 71755 |
2200 | IVS II-765 L1 insertion (+CTGCTTTTATTTT) | N/A | HBB:c.316-98_316-86dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71792 |
231 | CD 107 (+G) | N/A | HBB:c.323dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
1195 | CD 112-116 (+GTGTGCTGGCCC) | Hb Antibes-Juan-Les-Pins | HBB:c.338_349dupGTGTGCTGGCCC | β | Causative | β-chain variant | NG_000007.3 | 71912 |
2192 | CD 114/115 (+TGTGCTG) | N/A | HBB:c.339_345dupTGTGCTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
240 | CD 116 (+TGAT) | N/A | HBB:c.349_350insTGAT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71924 |
243 | CD 120/121 (+A) | N/A | HBB:c.363dupA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
3555 | CD 124 (+C) | N/A | HBB:c.374dup | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 71948 |
2194 | CD 124/125 (+A) | N/A | HBB:c.375dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
248 | CD 125 (+CCA) | N/A | HBB:c.376_378dupCCA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71950 |
3227 | CD 125-126 (+CCAGT) | N/A | HBB:c.376_380dupCCAGT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71950 |
2197 | CD 131 (+A) | N/A | HBB:c.395dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71969 |
259 | CD 131/132 (+GCCT) | N/A | HBB:c.396_397insGCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
2282 | CD 139/140 +T [163 aa] | Hb Boston-Kuwait | HBB:c.420dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71994 |
1306 | CD 145 (+CT) | Hb Cranston | HBB:c.436_437insCT | β | Causative | β-chain variant | NG_000007.3 | 72010 |
1319 | CD 146/147 (+AC) | Hb Tak | HBB:c.440_441dupAC | β | Causative | β-chain variant | NG_000007.3 | 72014 |
1320 | CD 147 (+TA) | Hb Monplaisir | HBB:c.442_443dupTA | β | Causative | β-chain variant | NG_000007.3 | 72016 |
3933 | 3'UTR +116 (+A) (β nt + 1590 (+A)) | N/A | HBB:c.*116dup | β | Causative | β-thalassaemia | NG_000007.3 | 72134 |
3930 | TTS +43 (+A) (β nt +1651 (+A)) | N/A | HBB:c.*177dup | β | Causative | β-thalassaemia | NG_000007.3 | 72195 |
4103 | p.Gly176AlafsX179 | N/A | NC_000019.10(NM_006563.5):c.525_526insGCGCCGG | KLF1 | Modifier | N/A | NG_013087.1 | 6499 |
2085 | CD 175/176 (+7bp): (+CGGCGCC) (c.519_525dupCGGCGCC, p.Gly176Argfs*179) | N/A | NG_013087.1:g.6493_6499dupCGGCGCC | KLF1 | Modifier | Hb F levels, Anaemia | NG_013087.1 | 6500 |
2278 | CD 302 (+4bp): (+GCGC) | N/A | NG_013087.1:g.6877_6878insGCGC | KLF1 | Modifier | Hb F levels | NG_013087.1 | 6877 |
2296 | CD 319 (+1bp): (+G) | N/A | NG_013087.1:g.7184dupG | KLF1 | Modifier | N/A | NG_013087.1 | 7184 |
2789 | rs3074372 | N/A | NG_023030.1:g.4828_4829insGT | HMOX1 | Modifier | Acute chest syndrome | NG_023030.1 | 4828 |
2867 | rs8175347 | N/A | NG_002601.2:g.175492_175493TA[5][6][7][8] | UGT1A1 | Modifier | Hb F levels, Gallstones, Bilirubin levels, Abnormal red blood cell count, Anaemia | NG_002601.2 | 175492 |
2287 | -126 (-TTT) (12020(T15>T18), c.-126TdelTTT, rs5816533 ) | N/A | NT_010393.16:g.31479059delTTT | AHSP | Modifier | Anaemia | NT_010393.16 | 31479059 |
2666 | rs3025058 (MMP3 -1171insA , -1171 5A/6A MMP-3) | N/A | NG_012100.1:g.3394_3395insT | MMP3 | Modifier | Stroke | NG_012100.1 | 3394 |
3219 | rs557939075 | N/A | NG_009929.2:g.459084_459085insA | LARGE1 | Modifier | Hb F levels | NG_009929.2 | 459084 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-12-12 10:33:52