IthaID: 2346
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -154 C>T | HGVS Name: | NG_013087.1:g.4910C>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GAAGTTTGTGCCCCAGAAACAGTGC [C/T] CCCCCGCCGCCTTGCCTTGCTTTGC (Strand: -)
Comments: Found as a compound heterozygote with p.A298P in a Thai patient with severe, transfusion-dependent hemolytic anemia characterized by abnormally low levels of the red cell enzyme pyruvate kinase, a known cause of chronic nonspherocytic hemolytic anemias (CNSHA). Persistent expression of fetal haemoglobin (Hb F) and expression of large quantities of embryonic globins in post-natal life. The change is predicted to alter the binding of transcription factors P53, Pax5 and ETF [PMID: 24443441]. Found as a compound heterozygote with p.Q217X in Thai patients homozygous or heterozygous for Hb E. Patients showed high levels of Hb F and lower MCV and MCH values compared to healthy controls [PMID: 27282573].
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | Increased expression for ε Increased expression for Aγ or Gγ |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 19 |
|---|---|
| Locus: | NG_013087.1 |
| Locus Location: | 4910 |
| Size: | 1 bp |
| Located at: | KLF1 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Thai |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Viprakasit V, Ekwattanakit S, Riolueang S, Chalaow N, Fisher C, Lower K, Kanno H, Tachavanich K, Bejrachandra S, Saipin J, Juntharaniyom M, Sanpakit K, Tanphaichitr VS, Songdej D, Babbs C, Gibbons RJ, Philipsen S, Higgs DR, Mutations in Kruppel-like factor 1 cause transfusion-dependent hemolytic anemia and persistence of embryonic globin gene expression., Blood , 2014 PubMed
- Tepakhan W, Yamsri S, Sanchaisuriya K, Fucharoen G, Xu X, Fucharoen S, Nine known and five novel mutations in the erythroid transcription factor KLF1 gene and phenotypic expression of fetal hemoglobin in hemoglobin E disorder., Blood Cells Mol. Dis. , 59(0), 85-91, 2016 PubMed