IthaID: 2465

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 19 GCG>GC- HGVS Name: HBA2:c.60delG
Hb Name: N/A Protein Info: p.His21Thrfs*29
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGCCGCCTGGGGTAAGGTCGGCGC [-/G] CACGCTGGCGAGTATGGTGCGGAG (Strand: +)

Comments: Detected as a homozygote and heterozygote in Iranian subjects with elevated Hb Bart's levels. The deletion of nt 'G' in codon 19 (GCG) creates a frameshift leading to a premature stop codon at codon 48 (TGA).

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33835
Size: 1 bp
Located at: α2
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Iranian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Harteveld CL, Yavarian M, Zorai A, Quakkelaar ED, van Delft P, Giordano PC, Molecular spectrum of alpha-thalassemia in the Iranian population of Hormozgan: three novel point mutation defects., American journal of hematology, 74(2), 99-103, 2003
Created on 2014-06-03 15:45:02, Last reviewed on 2022-11-21 13:28:49 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.