Loading... Please wait!
Quick filtering
Showing all entries assigned as Thalassaemia (Show All):
IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
---|---|---|---|---|---|---|---|---|
3998 | --259 | N/A | N/A | , | ||||
410 | -α3.7;CD 125 CTG>CAG [Leu>Gln] | N/A | N/A | α1 or α2, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
2244 | (αα)JM | N/A | NC_000016.10:48642_132584del | HS40, ζ, NPRL3 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
2248 | (αα)Sco | N/A | NC_000016.10:g.(93618_93635)_(141631_141648)del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
2252 | --BR | N/A | NC_000016.10:g.11555_229482del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
2268 | --BA | N/A | NC_000016.10:g.0_772369del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
2555 | α12 (HBA2 gene conversion) | N/A | N/A | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
2562 | (αα)HS40del (deletion of HS-40 region, chr16:g.(?_103625)_(163701_193676)del [GRCh37(hg19)]) | N/A | NC_000016.10:g.(?_53625)_(113702_143677)del | HS40 | Causative | α-thalassaemia | NG_000006.1 | |
3071 | --235 (--175) | N/A | NC_000016.10:g.10001_185264del | HS40, ζ, α2, α1, NPRL3 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
3275 | (αα)ALT | N/A | NC_000016.10:g.113194_116554delins39 | HS40 | Causative | α-thalassaemia | NG_000006.1 | |
3292 | 15 kb deletion | N/A | NC_000016.10:g.172736_187935del | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
3296 | --GB | N/A | NC_000016.9:g.(161901_161910)_(178672_178681)del | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
3407 | (αα)JS | N/A | NC_000016.10:g.46628_126325del | HS40, NPRL3 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
3588 | --OY | N/A | NC_000016.10:g.0_318541del | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
3622 | --71.8 (71.8 Kb deletion) | N/A | NC_000016.10:g.138971_210817del | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
3631 | -α3.7;CD 104 TGC>TAC | Hb Sallanches | N/A | α3.7 hybrid | Causative | α-thalassaemia | NG_000006.1 | |
3663 | HS-40 deletion | N/A | NC_000016.10:g.(47217_113592)_(113687_143639)del | HS40 | Causative | α-thalassaemia | NG_000006.1 | |
3711 | (αα)YD | N/A | NC_000016.10:g.94096_147948del | HS40 | Causative | α-thalassaemia | NG_000006.1 | |
3821 | --196 | N/A | NC_000016.10:g.35880_(232158_243266)del | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | |
3822 | --227 | N/A | NC_000016.10:g.35880_(262740_268502)del | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | |
3886 | (αα)107kb deletion | N/A | NC_000016.10:g.44082_151511del | HS40, NPRL3 | Causative | α-thalassaemia | NG_000006.1 | |
3889 | (αα)Aurora Borealis | N/A | NC_000016.10:g.(48303_50379)_ (165612_167685)del | HS40, ζ, NPRL3, HBM | Causative | α-thalassaemia | NG_000006.1 | |
3946 | 16 kb HS-40 deletion | N/A | NC_000016.10:g.100600_116678del | HS40, NPRL3 | Causative | α-thalassaemia | NG_000006.1 | |
3957 | 68.9 kb HS-40 deletion | N/A | NC_000016.10:g.52778_121630del | HS40, NPRL3 | Causative | α-thalassaemia | NG_000006.1 | |
4015 | --259 | N/A | NC_000016.10:g.27301_286500del | HS40, ζ, α2, α1, NPRL3 | Causative | α-thalassaemia | NG_000006.1 | |
4062 | 285 kb deletion | N/A | N/A | ζ, HS40, α2, α1, HBM, AXIN1 | Causative | α-thalassaemia | NG_000006.1 | |
4058 | --FG | N/A | N/A | α1, ζ, α2 | Causative | α-thalassaemia | NG_000006.1 | |
4059 | --Sciacca | N/A | N/A | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | |
4060 | --AG | N/A | NC_000016.10:g.10001_(284537_284542)del | HS40, ζ, α2, α1, NPRL3, HBM | Causative | α-thalassaemia | NG_000006.1 | |
4061 | --Puglia | N/A | NC_000016.10:g.(54016_55432)_(220780_223388)del | HS40, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | |
4095 | --Guigang (145 kb deletion) | N/A | NC_000016.10:g.127815_273190del | HS40, HBM, NPRL3, α1, α2, ζ | Causative | α-thalassaemia | NG_000006.1 | |
4090 | --Mococa (17 kb deletion) | N/A | NC_000016.10:g.(162059_162078)_(179126_179145)del | α1, α2 | Causative | α-thalassaemia | NG_000006.1 | |
4073 | (αα)FJ (--FJ) | N/A | NC_000016.10:g.39268_130758del | HS40 | Causative | α-thalassaemia | NG_000006.1 | |
4082 | --LAMPHUN (27 kb deletion with 9 bp insertion (Lamphun deletion)) | N/A | N/A | HBM, α1, ζ, α2 | Causative | α-thalassaemia | NG_000006.1 | |
306 | -α7.9 | N/A | NG_000006.1:g.28322_36260del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
307 | -α18 (18 kb deletion) | N/A | N/A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
316 | -(α)5.2 | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
322 | --CI (28+ kb deletion.) | N/A | NC_000016.10:g.(158380_161516)_ (186053_?) | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
324 | --115 | N/A | NC_000016.10:g.(13158_13584)_(39907_41256)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
326 | --YEM | N/A | NG_000006.1:g.(16201_17547)_(41420_42633)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
329 | --KOL | N/A | NC_000016.10:g.(151719_151746)_(185067_185093)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
330 | --11.1 (11.1 kb deletion) | N/A | NG_000006.1:g.(31695_31724)_(42846_42867)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
331 | --OH | N/A | NC_000016.10:g.(149158_152418)_(249560_284571)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
332 | (αα)RA | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
333 | (αα)TI | N/A | NC_000016.10:g.10023_122854del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
334 | (αα)IJ | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
335 | (αα)CMO | N/A | NC_000016.10:g.10018_157684del | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
336 | (αα)TAT | N/A | NC_000016.10:g.10020_152823del | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
337 | (αα)MB | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
338 | (αα)IC | N/A | NC_000016.10:g.10018_131194delinsAC | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
339 | (αα)IdF | N/A | NC_000016.10:g.10020_154449del | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2233 | -ζ | N/A | N/A | ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2234 | -α16.6 | N/A | NG_000006.1:g.(19842_19845)_(36479_36486)delins22446_24085inv | ζ, α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2235 | α-αΔ970 (970 bp deletion) | N/A | NG_000006.1:g.36599_37568delinsTAG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2236 | --DUTCH I | N/A | NG_000006.1:g.7622_41156del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2237 | --AW | N/A | NG_000006.1:g.32143_40317delinsCTCCCTGGACAAGT | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2238 | --BGS | N/A | NC_000016.10:g.47749_179374del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2239 | --CAMPANIA | N/A | NC_000016.10:g.(8635_8924)_(39835_40133)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2240 | --FIL-2 (27.9 deletion) | N/A | NC_000016.10:g.156188_184103del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2241 | --ED | N/A | NC_000016.10:g.(110582_113386)_(187266_188773)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2242 | --GP | N/A | NC_000016.10:g.(43803_47123)_(187266_188649)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2243 | (αα)AS | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2245 | (αα)MM | N/A | NC_000016.10:g.(?_53322)_(141396_143702)del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2246 | (αα)L | N/A | NC_000016.10:g.(?_55799)_(152345_162796)del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2247 | (αα)SN | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2249 | (αα)ZW | N/A | NC_000016.10:g. 90778_106773del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2250 | (αα)RSR | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2251 | (αα)MCu | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2253 | --ZW | N/A | NC_000016.10:g.11555_229482del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2254 | --JY | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2255 | --LC | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2256 | --VR | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2257 | --JT | N/A | NC_000016.10:g.(44035_44092)_(312033_312090)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2258 | --AB | N/A | NC_000016.10:g.(?_55799)_(360870_410354)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2259 | --GZ | N/A | NC_000016.10:g.(?_53322)_(879639_910965)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2260 | Dutch II | N/A | NC_000016.10:g.(?_55799)_(284538_298092)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2261 | --MK | N/A | NC_000016.10:g.(113696_130566)_(298093_ 331093)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2262 | --80 | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2264 | --Brazil | N/A | NC_000016.10:g.(?_55799)_(986613_1063737)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2265 | --PV | N/A | NC_000016.10:g.(?_55799)_(1625950_1740473)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2266 | --HN | N/A | NC_000016.10:g.(?_55799)_(1923864_ 1939057)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2267 | --FT | N/A | NC_000016.10:g.(?_55799)_(1857769_1890275)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2269 | --TN | N/A | NC_000016.10:g.0_976709del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2270 | --BO | N/A | NC_000016.10:g.0_1896761del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2271 | --IM | N/A | NC_000016.10:g.0_2021644del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2272 | --LIN | N/A | NC_000016.10:g.0_2023655del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
2273 | --GS | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3021 | --JAL | N/A | NC_000016.10:g.(149437_149482)_(179595_179654)del | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3022 | --LOD | N/A | NC_000016.10:g.(45349_45393)_(262286_262330)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3067 | --MEX1 | N/A | NG_000006.1:g.3(33114_33812)_(40649_42021)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3068 | --MEX2 | N/A | NC_000016.10:g.(113775_130542)_(208161_249560)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3074 | (αα)JX | N/A | NC_000016.10:g.113161_113902del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3142 | -α6.3 | N/A | NG_000006.1:g.31022_37366del6344 | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3215 | --Braz | N/A | NC_000016.10:g.(167305_169853)_(239884_271794)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3244 | −KOZANI | N/A | NC_000016.10:g.(113686_143638)_(407521_?)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3255 | --MEX3 | N/A | NC_000016.10:g.151479_182582del | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 0 |
3258 | --NFLD | N/A | NC_000016.10:g.169197_259919delinsCACCCAGCACCCAGTACCA | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3273 | --VS | N/A | NC_000016.10:g.(100364_105222)_(376261_986851)del | HS40, ζ, α2, α1, HBM, AXIN1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3274 | --CBR | N/A | NC_000016.10:g.(?_53322)_(177893_179815)del | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 0 |
3283 | --JS | N/A | NG_000006.1:g.35801_38338delinsGGCCTCCCAACGGGCCCTCCTCCCCTCCT | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 0 |
3284 | --PG | N/A | NC_000016.10:g.93628_542759del450131 | HS40, ζ, α2, α1, NPRL3, HBM, AXIN1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3293 | 97 kb deletion | N/A | NC_000016.10:g.56407_153678del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3295 | 225 kb deletion | N/A | NC_000016.10:g.56407_281805del | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3327 | --GX | N/A | NC_000016.10:g.(41492_43628)_(247888_254167)del | HS40, ζ, α2, α1, NPRL3, HBM | Causative | α-thalassaemia | NG_000006.1 | 0 |
3440 | -αMAL3.5 | N/A | NG_000006.1:g.32745_36301del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
3514 | 170 kb deletion | N/A | N/A | α2, α1, AXIN1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
327 | --MC | N/A | NC_000016.10:g.139301_182501del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 164 |
3607 | 63 Kb deletion | N/A | NC_000016.10:g.(143655_149367)_(181204_206338)del | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 4518 |
3214 | 44.6 kb deletion | N/A | NC_000016.10:g.144215_188841del | ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 5078 |
3595 | --CR | Hb Chiang Rai | NC_000016.10:g.144215_188843del | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 5078 |
2554 | -α28.5 | N/A | NG_000006.1g.7065_35627del28563 | ζ, α2 | Causative | α-thalassaemia | NG_000006.1 | 7065 |
4057 | --PA | N/A | NC_000016.10:g.(146281_146304)_(180074_180097)del | α2, HBM, ζ, α1 | Causative | α-thalassaemia | NG_000006.1 | 7144 |
3408 | --60.2 | N/A | NC_000016.10:g.147589_207883del | ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8452 |
323 | --CAL | N/A | NG_000006.1:g.8464_40664del32201 | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8464 |
313 | --MED II | N/A | NG_000006.1:g.(7740_9712)_(39907_41156)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8726 |
3020 | --DANE | N/A | NG_000006.1: g.8800_40007del31208 | ζ, α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 8800 |
2232 | -α27.6 | N/A | NG_000006.1:g.9079_36718del27640 | ζ, α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 9079 |
4110 | 146 kb deletion | N/A | NC_000016.10:g.148636_295089del | ζ, α2, α1, HBM, AXIN1 | Causative | α-thalassaemia | NG_000006.1 | 9499 |
3963 | 32.8 kb deletion | N/A | NC_000016.10:g.149860_182697del | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 10723 |
310 | --THAI | N/A | NC_000016.10:g.149863_183312del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 10726 |
325 | --RT | N/A | NC_000016.10:g.151401_188301del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 12264 |
311 | --FIL | N/A | NC_000016.10:g.151641_182316del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 12504 |
321 | --CL | N/A | NC_000016.10:g.152451_263801del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 13314 |
2475 | 21.9 kb deletion with 29 bp insertion (Qinzhou type deletion) | N/A | NG_000006.1:g.[14373_36299del21927; insGGGAAGGGTGGGTGGGAATAACAGCTTTT] | ζ, α2 | Causative | α-thalassaemia | NG_000006.1 | 14373 |
4019 | 27.2 kb deletion (--27.2) | N/A | NC_00016.10:g.154539_181778delinsTAACA | ζ, α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 15402 |
320 | --BRIT | N/A | NC_000016.10:g.155501_184801del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 16364 |
314 | -(α)20.5 | N/A | NG_000006.1:g.(18148_18200)_(37868_37901)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 18200 |
319 | --MA | N/A | NG_000006.1:g.18964_39864del20901 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 18964 |
315 | --SA | N/A | NC_000016.10:g.159052_182788delins139752_139596 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 19464 |
3947 | 27.3 kb deletion | N/A | NC_000016.10:g.158664_185974del | α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 19527 |
3294 | 22 kb deletion | N/A | NG_000006.1:g.20350_42078del | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 20350 |
312 | --MED I | N/A | NG_000006.1:g.(23641_23662)_(41183_41203)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 23662 |
3945 | 15.8 kb deletion (NG_000006.1:g.24749_40631del) | N/A | NC_000016.10:g.163886_179768del | α2, α1, HBM | Causative | α-thalassaemia | NG_000006.1 | 24749 |
309 | --SEA | N/A | NC_000016.10:g.165401_184701del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 26264 |
305 | -α5.3 | N/A | NG_000006.1:g.28684_33930del5246 | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 28684 |
328 | --CANT | N/A | NC_000016.10:g.(168531_169756)_(182770_183028)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 29394 |
4020 | 14.9 kb deletion | N/A | NC_00016.10:g.168803_183737del | α1, α2 | Causative | α-thalassaemia | NG_000006.1 | 29666 |
3603 | -α6.9 | N/A | NG_000006.1:g.29785_36746del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 29785 |
318 | --SPAN | N/A | NC_000016.10:g.(169756_170100)_(179044_181595)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 30619 |
301 | -α4.2 | N/A | NC_000016.10:g.169818_174075del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 30681 |
3966 | 5.9 kb deletion | N/A | NG_000006.1:g.30779_36726del | α2 | Causative | α-thalassaemia | NG_000006.1 | 30779 |
3018 | --NOR | N/A | NC_000016.10:g.170694_184101del | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 31577 |
3360 | 9.7 kb deletion | N/A | NG_000006.1:g.32709_42418del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 32709 |
317 | --GEO | N/A | NG_000006.1:g.32864_42264del9401 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 32864 |
3268 | 811 bp deletion | N/A | NG_000006.1:g.32945_33755 | α2 | Causative | α-thalassaemia | NG_000006.1 | 32945 |
3994 | 10.3 kb deletion | N/A | NC_000016.10:g.172342_182690del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33205 |
4083 | -(α)4.9 (4.9 Kb deletion) | N/A | NC_000016.10:g.172367_177259delinsG | α1, α2 | Causative | α-thalassaemia | NG_000006.1 | 33230 |
2988 | -54 G>A | N/A | HBA2:c.-91G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33685 |
2967 | -22 C>T | N/A | HBA2:c.-59C>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33717 |
3725 | -4 G>C | N/A | HBA2:c.-41C>G | α2 | Causative | α-thalassaemia | NG_000006.1 | 33735 |
3726 | Cap +11 T>A | N/A | HBA2:c.-27T>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33749 |
3727 | Cap +23 C>G | N/A | HBA2:c.-15C>G | α2 | Causative | α-thalassaemia | NG_000006.1 | 33761 |
3728 | Cap +30 A>C | N/A | HBA2:c.-8A>C | α2 | Causative | α-thalassaemia | NG_000006.1 | 33768 |
346 | -α3.7;Init CD ACCATG>--CATG | N/A | NG_000006.1:g.[33773_33774del;34247_38050del] | α2, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33773, 34247 |
3051 | Init CD ACCATG>-CCATG | N/A | HBA2:c.-3delA | α2 | Causative | α-thalassaemia | NG_000006.1 | 33773 |
344 | Init CD ATG>-TG | N/A | HBA2:c.1delA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33776 |
345 | -α3.7;Init CD ATG>GTG | N/A | NG_000006.1:g.[33776A>G;34247_38050del] | α2, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33776, 34247 |
3050 | Init CD ATG>TTG [Met>Leu] | N/A | HBA2:c.1A>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33776 |
3604 | Init CD ATG>GTG [Met>Pro] | N/A | HBA2:c.1A>G | α2 | Causative | α-thalassaemia | NG_000006.1 | 33776 |
342 | Init CD ATG>ACG [Met>Thr] | N/A | HBA2:c.2T>C | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
343 | Init CD ATG>A-G | N/A | HBA2:c.2delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
2460 | Init CD ATG>AGG [Met>Arg] | N/A | HBA2:c.2T>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
3754 | Init CD ATG>AAG [Met>Lys] | N/A | HBA2:c.2T>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33777 |
3564 | Init CD ATG>ATC [Met>Ile] | N/A | HBA2:c.3G>C | α2 | Causative | α-thalassaemia | NG_000006.1 | 33778 |
4071 | CD 1 (-G) | N/A | HBA2:c.4del | α2 | Causative | α-thalassaemia | NG_000006.1 | 33779 |
3720 | CD 1/2 (+TG) | N/A | HBA2:c.6_7insTG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33781 |
2469 | CD 7 AAG>TAG | N/A | HBA2:c.22A>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33797 |
4011 | CD 9 AAC>TAC [Asn>Tyr] | N/A | HBA2:c.28A>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33803 |
3991 | CD 10 GTC>GAC [Val>Asp] | Hb Chumphae | HBA2:c.32T>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33807 |
2518 | CD 14 TGG>TGA | N/A | HBA2:c.45G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33820 |
4024 | CD 15 (-GG, +C) | N/A | HBA2:c.46_47delinsC | α2 | Causative | α-thalassaemia | NG_000006.1 | 33821 |
4063 | CD 15 (-G, +CC) | N/A | HBA2:c.47delinsCC | α2 | Causative | α-thalassaemia | NG_000006.1 | 33822 |
3714 | CD 15/16 (+T) | N/A | HBA2:c.48_49insT | α2 | Causative | α-thalassaemia | NG_000006.1 | 33823 |
3885 | CD 17 (-C) (Hb Kunming) | N/A | HBA2:c.54delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 33829 |
350 | CD 18 GGC>G-C | N/A | HBA2:c.56delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33831 |
2465 | CD 19 GCG>GC- | N/A | HBA2:c.60delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33835 |
2207 | CD 21/22 +T | N/A | HBA2:c.66dupT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33841 |
352 | CD 22 GGC>GGT new donor consensus | N/A | HBA2:c.69C>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33844 |
353 | CD 22 -C | N/A | HBA2:c.69delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33844 |
354 | CD 23 GAG>TAG [Glu>STOP] | N/A | HBA2:c.70G>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33845 |
2208 | CD 24 TAT>TAG | N/A | HBA2:c.75T>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33850 |
2488 | CD 24 TAT>TAA | N/A | HBA2:c.75T>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33850 |
3657 | CD 26 GCG>ACG [Ala>Thr];CD 130 GCT>CCT [Ala>Pro] | Hb Southern Italy | HBA2:c.[79G>A;391G>C] | α2 | Causative | α-thalassaemia | NG_000006.1 | 33854, 34425 |
3568 | CD 28 GCC>-CC | N/A | HBA2:c.85delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33860 |
357 | CD 30 -GAG [-Glu] | N/A | HBA2:c.91_93delGAG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33866 |
365 | -α3.7;CD 31 AGG>--G | N/A | NG_000006.1:g.[33869_33870del;34247_38050del] | α2, α3.7 hybrid | Causative | α-thalassaemia | NG_000006.1 | 33869, 34247 |
2210 | CD 31 AGG>CGG [Arg>Arg] | N/A | HBA2:c.94A>C | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33869 |
366 | CD 31 AGG>AAG [Arg>Lys] | N/A | HBA2:c.95G>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33870 |
2483 | IVS I-1 G>T | N/A | HBA2:c.95+1G>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33871 |
3745 | IVS I-1 G>A | N/A | HBA2:c.95+1G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33871 |
359 | IVS I-1 (-5 bp) GAGGTGAGG>GAGG----- donor (α-5nt) | N/A | HBA2:c.95+2_95+6delTGAGG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33872 |
360 | IVS I-5 G>A | N/A | HBA2:c.95+5 G>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33875 |
4043 | IVS I-57 C>T | N/A | HBA2:c.95+7C>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33877 |
3729 | IVS I-11 (-24bp) (Hb Qujing) | N/A | HBA2:c.95+11_95+34del | α2 | Causative | α-thalassaemia | NG_000006.1 | 33881 |
362 | IVS I-55 G>A | N/A | HBA2:c.95+55 G>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33925 |
3976 | IVS I-68 G>A | N/A | HBA2:c.96-50G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33938 |
3730 | IVS I-73 G>A | N/A | HBA2:c.96-45G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33943 |
3877 | IVS I-114 G>T | N/A | HBA2:c.96-4G>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 33984 |
363 | IVS I-116 GCAGGA>GCGGGA acceptor | N/A | HBA2:c.96-2A>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33986 |
2957 | IVS I-117 G>A | N/A | HBA2:c.96-1G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 33987 |
2211 | CD 37 CCC>CC- | N/A | HBA2:c.114delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34006 |
372 | CD 39-41 (-9 bp, + 8 bp) | N/A | NG_000006.1:g.34010_34018delinsTACTTCCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34010 |
2493 | CD 40 AAG>AA- | N/A | HBA2:c.123delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34015 |
2214 | CD 43 TTC>T-C | N/A | HBA2:c.131delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34023 |
2215 | CD 43/44 -C | N/A | HBA2:c.132delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34024 |
3405 | CD 47-53 (-20bp): (-GACCTGAGCCACGGCTCTGC) | N/A | HBA2:c.142_161del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34034 |
2216 | CD 47 -A | N/A | HBA2:c.143delA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34035 |
3053 | CD 47/48 (-4bp): (-ACCT) | N/A | HBA2:c.143_146delACCT | α2 | Causative | α-thalassaemia | NG_000006.1 | 34035 |
374 | CD 49 -GC | N/A | HBA2:c.149_150delGC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34041 |
2217 | CD 51/52 +G | N/A | HBA2:c.156_157insG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34048 |
376 | CD 54 (CAG>TAG) | N/A | HBA2:c.163C>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34055 |
3693 | CD 54 CAG>-AG | N/A | HBA2:c.163delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34055 |
3079 | CD 55 +T | N/A | HBA2:c.168dup | α2 | Causative | α-thalassaemia | NG_000006.1 | 34060 |
3054 | CD 56 AAG>--G | N/A | HBA2:c.169_170delAA | α2 | Causative | α-thalassaemia | NG_000006.1 | 34061 |
3286 | CD 61 AAG>TAG [Lys>STOP] | N/A | HBA2:c.184A>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34076 |
2218 | CD 63-76 (-42 bp) | N/A | HBA2:c.190_231del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34082 |
2576 | CD 68 AAC>A-C | N/A | HBA2:c.206delA | α2 | Causative | α-thalassaemia | NG_000006.1 | 34098 |
4070 | CD 68 (-C) | N/A | HBA2:c.207del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34099 |
3705 | CD 72 (+C) | N/A | HBA2:c.217dup | α2 | Causative | α-thalassaemia | NG_000006.1 | 34109 |
3055 | CD 73/74 (-4bp): (-GTGG) | N/A | HBA2:c.220_223delGTGG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34112 |
3632 | CD 76/77 (+T) | N/A | HBB:c.231_232insT | α2 | Causative | α-thalassaemia | NG_000006.1 | 34123 |
3974 | CD 82-83 (-CCTG) | N/A | HBA2:c.249_252del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34141 |
3569 | CD 89-93 (-13bp): (-CACAAGCTTCGGG) | N/A | HBA2:c.268_280delCACAAGCTTCGGG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34160 |
388 | CD 90 AAG>TAG | N/A | HBA2:c.271A>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34163 |
3572 | CD 90‐92 (-8bp): (‐AGCTTCGG) | N/A | HBA2:c.272_279delAGCTTCGG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34164 |
3080 | CD 94 (+21 bp duplication) | Hb SKMC | HBA2:c.283_300+3dup | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34175 |
3610 | CD 99 AAG>TAG [Lys>STOP] | N/A | HBA2:c.298A>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 34190 |
391 | IVS II-2 GT>GA donor | N/A | HBA2:c.300+2T>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34194 |
3731 | IVS II-34 G>A | N/A | HBA2:c.300+34G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 34226 |
300 | -α3.7 (type I) (-α3.7) | N/A | NG_000006.1:g.34247_38050del | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34247 |
2430 | 203 bp deletion | N/A | NG_000006.1:g.34305_34507del203 | α2 | Causative | α-thalassaemia | NG_000006.1 | 34305 |
392 | IVS II-142 G>A | N/A | HBA2:c.301-1G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 34334 |
3611 | CD 108 ACC>GCC [Thr>Ala] | N/A | HBA2:c.325A>G | α2 | Causative | α-thalassaemia | NG_000006.1 | 34359 |
4068 | CD 112 CAC>-AC | N/A | HBA2:c.337delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34371 |
402 | CD 112/113 -C | N/A | HBA2:c.339delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34373 |
2527 | CD 114 (+CC) | N/A | HBA2:c.344_345dup | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34378 |
3140 | CD 114 CCC>CC- | N/A | HBA2:c.345delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34379 |
405 | CD 116 GAG>TAG | N/A | HBA2:c.349G>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34383 |
2221 | CD 115 -GAGTTCACCCC [166 aa] | N/A | HBA2:c.349_359delGAGTTCACCCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34383 |
3862 | CD 125 (+C) | N/A | HBA2:c.376dupC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34410 |
3305 | CD 126 GCG>-CG | N/A | HBA2:c.379delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34413 |
2519 | CD 127 AAG>TAG [Lys>STOP] | N/A | HBA2:c.382A>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 34416 |
3612 | CD 127 AAG>ATG [Lys>Met] | N/A | HBA2:c.383A>T | α2 | Causative | α-thalassaemia | NG_000006.1 | 34417 |
3613 | CD 129 CTG>CGG [Leu>Arg] | N/A | HBA2:c.389T>G | α2 | Causative | α-thalassaemia | NG_000006.1 | 34423 |
2230 | -α3.7 (type II) | N/A | NG_000006.1:g.34478_38288del | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34478 |
2226 | 3'UTR +46 C>A | N/A | HBA2:c.*46C>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34509 |
3753 | 3'UTR +71 G>C | N/A | HBA2:c.*71G>C | α2 | Causative | α-thalassaemia | NG_000006.1 | 34534 |
428 | 3'UTR -16 bp | N/A | HBA2:c.*74_*89delCCTTCCTGGTCTTTGA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34537 |
3733 | 3'UTR +82 G>A | N/A | HBA2:c.*82G>A | α2 | Causative | α-thalassaemia | NG_000006.1 | 34545 |
4041 | 3.8 kb deletion | N/A | NC_000016.10:g.173682_177493del | α2, α1 | Causative | α-thalassaemia | NG_000006.1 | 34545 |
4111 | Poly A (AATAAA>AAΑΑΑ) | N/A | HBA2:c.*91delT | α2 | Causative | α-thalassaemia | NG_000006.1 | 34554 |
425 | Poly A (AATAAA>AATGAA) (αPolyA2) | N/A | HBA2:c.*92A>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34555 |
426 | Poly A (AATAAA>AATA--) | N/A | HBA2:c.*93_*94delAA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34556 |
424 | Poly A (AATAAA>AATAAG) (αPolyA1, αT-Saudi) | N/A | HBA2:c.*94A>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34557 |
427 | Poly A (AATAAA>AATAAC) | N/A | HBA2:c.*94A>C | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34557 |
3734 | 3'UTR +98 T>C | N/A | HBA2:c.*98T>C | α2 | Causative | α-thalassaemia | NG_000006.1 | 34561 |
2228 | 3'UTR +107 A>G (3' UTR +832 G>A) | N/A | HBA2:c.*107A>G | α2 | Causative | α-thalassaemia | NG_000006.1 | 34570 |
2231 | -α3.7 (type III) | N/A | NG_000006.1:g.34570_38381del | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34570 |
2263 | α-ZF | N/A | NC_000016.10:g.174046_192396del | α1 | Causative | α-thalassaemia | NG_000006.1 | 34909 |
303 | -α2.7 | N/A | NG_000006.1:g.36664_39364del2701 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 36664 |
302 | -α2.4 | N/A | NG_000006.1:g.36859_39252del | α1 | Causative | α-thalassaemia | NG_000006.1 | 36859 |
304 | -α3.5 | N/A | NG_000006.1:g.37464_40964del3501 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37464 |
3764 | -4 G>C | N/A | HBA1:c.-41C>G | α1 | Causative | α-thalassaemia | NG_000006.1 | 37539 |
340 | CAP +22 T>C | N/A | HBA1:c.-16T>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37564 |
3735 | Cap +23 C>G | N/A | HBA1:c.-15C>G | α1 | Causative | α-thalassaemia | NG_000006.1 | 37565 |
2203 | CAP +29 (G>C) | N/A | HBA1:c.-9G>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37571 |
341 | Init CD ATG>GTG | N/A | HBA1:c.1A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37580 |
3147 | Init CD ATG>AAG [Met>Lys] | N/A | HBA1:c.2T>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37581 |
3250 | Init CD ATG>A-G | N/A | HBA1:c.2delT | α1 | Causative | α-thalassaemia | NG_000006.1 | 37581 |
3719 | Init CD ATG>ACG [Met>Thr] | N/A | HBA1:c.2T>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37581 |
4006 | CD 7 AAG>A-G (g.188 (GenBank MK600512.1)) | N/A | HBA1:c.23delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37602 |
349 | CD 14 TGG>TAG [Trp>STOP] | N/A | HBA1:c.44G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37623 |
3395 | CD 16 AAG>TAG [Lys>STOP] | N/A | HBA1:c.49A>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37628 |
3266 | CD 22 GGC>GGT [Gly>Gly] | N/A | HBA1:c.69C>T | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37648 |
3267 | CD 23 GAG>TAG | N/A | HBA1:c.70G>T | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37649 |
3942 | CD 26 GCG>GGG [Ala>Gly] | N/A | HBA1:c.80C>G | α1 | Causative | α-thalassaemia | NG_000006.1 | 37659 |
3032 | CD 28 GCC>TCC [Ala>Ser] | N/A | HBA1:c.85G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37664 |
3030 | CD 30 GAG>TAG | N/A | HBA1:c.91G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37670 |
358 | IVS I-1 AGGT>AGAT donor | N/A | HBA1:c.95+1G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37675 |
3049 | IVS I-1 AGGT>AGCT donor | N/A | HBA1:c.95+1G>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37675 |
2204 | IVS I-4 A>G | N/A | HBA1:c.95+4A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37678 |
361 | IVS I-5 G>A | N/A | HBA1:c.95+5 G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37679 |
3431 | IVS I-38 C>T | N/A | HBA1:c.95+38C>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37712 |
2212 | IVS I-45 G>C | N/A | HBA1:c.95+45G>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37719 |
2451 | IVS I-116 A>G | N/A | HBA1:c.96-2A>G | α1 | Causative | α-thalassaemia | NG_000006.1 | 37790 |
364 | IVS I-117 GCAGGA>GCAAGA acceptor | N/A | HBA1:c.96-1G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37791 |
3251 | IVS I-117 GCAGGA>GCACGA acceptor | N/A | HBA1:c.96-1G>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37791 |
4077 | CD 37 CCC>CC- | N/A | HBA1:c.114del | α1 | Causative | α-thalassaemia | NG_000006.1 | 37810 |
3403 | CD 39 +A | N/A | HBA2:c.118_119insA | α2 | Causative | α-thalassaemia | NG_000006.1 | 37814 |
3856 | CD 40-41 (-AAGACC) | N/A | HBA1:c.121_126delAAGACC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37817 |
2468 | CD 44 +C | N/A | HBA1:c.134_135insC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37830 |
375 | CD 51-55 (-13 bp deletion) | N/A | HBA1:c.155_167delGCTCTGCCCAGGT | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37851 |
4009 | CD53 GCC>ACC [Ala>Thr] (g.443 (GenBank MK600512.1)) | N/A | HBA1:c.160G>A | α1 | Causative | α-thalassaemia | NG_000006.1 | 37856 |
2417 | CD 54 CAG>CGG [Gln>Arg] | Hb Shimonoseki | HBA1:c.164A>G | α1, α3.7 hybrid | Causative | α-thalassaemia | NG_000006.1 | 37860 |
3334 | CD 61 AAG>TAG [Lys>STOP] | N/A | HBA1:c.184A>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37880 |
3717 | CD 61 AAG>-AG | N/A | HBA1:c.184del | α1 | Causative | α-thalassaemia | NG_000006.1 | 37880 |
2429 | CD 62 GTG>GCG [Val>Ala] | N/A | HBA1:c.188T>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 37884 |
2347 | CD 62 -G | N/A | HBA1:c.189delG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37885 |
3373 | CD 67 ACC>-CC | N/A | HBA1:c.202delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37898 |
4007 | CD 70 GTG>TTG [Val>Leu] (g.494 (GenBank MK600512.1)) | N/A | HBA1:c.211G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37907 |
385 | CD 74/75 -GAC [- Asp] | N/A | HBA1:c.212_214delGAC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37908 |
4008 | CD 72 CAC>CA- (g.502 (GenBank: MK600512.1)) | N/A | HBA1:c.219delC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37915 |
3326 | CD 73 GTG>G-G | N/A | HBA1:c.221delT | α1 | Causative | α-thalassaemia | NG_000006.1 | 37917 |
386 | CD 78 -C | N/A | HBA1:c.237delC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37933 |
2219 | CD 81 -T | N/A | HBA2:c.244delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37940 |
387 | CD 82-84 (-9 bp) | N/A | HBA1:c.247_255del | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37943 |
3861 | CD 87 (-A) | N/A | HBA1:c.263delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37959 |
390 | CD 93-99 (+21 bp) | N/A | HBA1:c.280_300ins21 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37976 |
2467 | CD 99 AAG>TAG | N/A | HBA1:c.298A>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 37994 |
3031 | IVS II-1 G>A | N/A | HBA1:c.300+1G>A | α1 | Causative | α-thalassaemia | NG_000006.1 | 37997 |
3736 | IVS II-55 G>T | N/A | HBA1:c.300+55G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 38051 |
3737 | IVS II-58 G>A | N/A | HBA1:c.300+58G>A | α1 | Causative | α-thalassaemia | NG_000006.1 | 38054 |
4005 | IVS II-96 G>C (g.679 (GenBank MK600512.1)) | N/A | HBA1:c.300+96G>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 38092 |
4042 | IVS II-2 (-8 bp, +1 bp) | N/A | HBA1:c.301-31_301-24delinsG | α1 | Causative | α-thalassaemia | NG_000006.1 | 38115 |
3738 | IVS II-141 T>C | N/A | HBA1:c.301-9T>C | α1 | Causative | α-thalassaemia | NG_000006.1 | 38137 |
2222 | IVS II-147 C>G | N/A | HBA1:c.301-3C>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38143 |
393 | IVS II-148 A>G consensus | N/A | HBA1:c.301-2A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38144 |
2224 | CD 110-114 (-13 bp) | N/A | HBA1:c.333_345delCGCCCACCTCCCC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38178 |
3864 | CD 116 GAG>TAG [Glu>Stop] | N/A | HBA1:c.349G>T | α1 | Causative | α-thalassaemia | NG_000006.1 | 38194 |
4084 | CD 133-135 (-7 bp, -GCACCGT) | N/A | HBA1:c.401_407del | α1 | Causative | α-thalassaemia | NG_000006.1 | 38246 |
3302 | 3'UTR +46 C>A | N/A | HBA1:c.*46C>A | α1 | Causative | α-thalassaemia | NG_000006.1 | 38320 |
2225 | Poly A (G>A) AATAAAG>AATAAAA | N/A | HBA1:c.*96G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38370 |
3739 | TTS +23 (+T) | N/A | HBA1:c.*134_*135insT | α1 | Causative | α-thalassaemia | NG_000006.1 | 38408 |
1525 | Belgian (Aγδβ)0 | N/A | NC_000011.10:g.(5200077_5215844)_(5249806_5251160)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | |
1540 | Hispanic (εγδβ)0 | N/A | NC_000011.10:g.5279573_5319355del | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | |
1542 | Dutch I (εγδβ)0 | N/A | NC_000011.10:g.5229432_5329263del | βLCR, ε, Aγ, Gγ, δ, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
1549 | Dutch IV | N/A | NC_000011.10:g.(5245669_5248365)_(5440251_5470849)del | βLCR, ε, Aγ, Gγ, OR51B5, OR51B6 | Causative | εγδβ-thalassaemia | NG_000007.3 | |
1550 | Dutch V | N/A | NC_000011.10:g.(5269965_5275919)_(5409809_5430375)del | βLCR, OR51B5, OR51B6, OR51M1, OR51B2, OR51B4 | Causative | εγδβ-thalassaemia | NG_000007.3 | |
2159 | (εγδβ)0 with α triplication | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | |
2418 | Swiss (εγδβ)0 | N/A | NC_000011.10:g.(4002734_4002784)_ (6907712_6907762)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
2548 | Inv-Del English V | N/A | NC_000011.10:g.5194460_5253454invdel5194460_5194542del5253454_5375965 | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | |
3393 | 3.5 kb deletion (Thai, 3485 bp deletion) | N/A | NC_000011.10:g.5224302_5227791del3490bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | |
3570 | 1.78Mb εγδβ(0) del (Bedouin) | N/A | NC_000011.10:g.(4302665_4322227)_(6099443_6100105)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
3578 | 2.2 Mb deletion | N/A | NC_000011.10:g.4052720_6253287del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
3606 | 177 Kb deletion | N/A | NC_000011.10:g.5241050_5418009del | βLCR, ε, Aγ, Gγ, pseudo β, OR51B5, OR51B6, OR51M1, OR51B2 | Causative | εγδβ-thalassaemia | NG_000007.3 | |
3955 | Siriraj I Gγ(Aγδβ)0 (~118 kb del) | N/A | N/A | Aγ, δ, β | Causative | δβ-thalassaemia | NG_000007.3 | |
291 | Czech (4237 bp deletion) | N/A | NG_000007.3:g.67258_71501del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
293 | Cape Verdean | N/A | NG_000007.3:g.71548_79271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
294 | Asian Indian (10329 bp deletion) | N/A | NG_000007.3:g.(67531_67533)_(77874_77876)del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
295 | Australian (Anglo Saxon) (12023 bp deletion) | N/A | NC_000011.10:g.5215894_5227926del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
299 | Italian (~67 kb deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
1511 | East European (δβ)0 | N/A | NG_000007.3:g.61566_70708del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1514 | Macedonian/Turkish (δβ)0 (Turkish type 2 (δβ)0 | Turkish Inv/Del (δβ)0) | N/A | N/A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1515 | Turkish (δβ)0 (Turkish type 3 (δβ)0) | N/A | N/A | δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1516 | Leiden 7.4 kb (δβ)0 | N/A | NG_000007.3:g.(59658_64667)_(72019_81668)del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1517 | Thai 11.3 (δβ)0 | N/A | NG_000007.3:g.60045_71313delinsTACATTAAGAGATACCTTAATG | δ, β | Causative | δβ-thalassaemia, Hb F levels | NG_000007.3 | 0 |
1518 | Japanese 2 (δβ)0 | N/A | NG_000007.3:g.52036_78987del | δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1519 | Indian (Aγδβ)0 (inv) (Asian-Indian Inv/Del Gγ(Aγδβ)0) | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1521 | Cantonese (Aγδβ)0 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1522 | Malaysian-1 (Aγδβ)0 | N/A | N/A | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1528 | Yunnanese (Aγδβ)0 | N/A | NC_000011.10:g.5182845_5249973del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1531 | Canadian (Aγδβ)0 | N/A | NC_000011.10:g.5196589_5251715delinsTA | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1532 | Leiden 69.5 | N/A | NC_000011.10:g.(5167906_5178684)_(5248184_5251232)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1533 | 49.3 kb Gγ(Aγδβ)0 Asian del | N/A | NC_000011.10:g.5201244_5250542del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 0 |
1534 | Anglo-Saxon (εγδβ)0 | N/A | NC_000011.8:g.5204501_5300223del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1535 | Irish (εγδβ)0 | N/A | NC_000011.8:g.5110112_5312961del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1536 | Canadian (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1537 | Scottish - Irish | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1538 | English I (εγδβ)0 | N/A | N/A | βLCR, ε, Gγ | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1539 | Mexican (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1541 | Croatian (εγδβ)0 | N/A | NC_000011.10:g.(5151491_5158092)_(5285862_5295096)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1543 | English II | N/A | NC_000011.10:g.5262849_5360616del | βLCR, ε | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1544 | English III | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1545 | English IV | N/A | NC_000011.10:g.5156866_5595894del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1546 | Chilean | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1547 | Dutch II | N/A | NC_000011.10:g.(?_4999945)_(5409809_5430440)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β, OR51V1, OR51B5, OR51M1 | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1548 | Dutch III | N/A | NC_000011.10:g.5248950_5360936delinsGGGAGACTGATATA | βLCR, ε, Aγ, Gγ | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1551 | Dutch VI | N/A | NC_000011.10:g.(?_5227218)_(5373082_5382848)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1552 | Japanese | N/A | NC_000011.10:g.4600605_6019332delinsCACTTGGTTATGATGTATT | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
1553 | French | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2123 | 7719 bp deletion | N/A | NG_000007.3:g.71550_79270del7719 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
2158 | Pakistani I | N/A | NC_000011.10:g.5194461_5700474delins[250inv] | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2161 | French (εγδβ)0 insertion/deletion | N/A | NG_000007.3:g.7751_18905delins[13569_13579inv;13364_13549inv] | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2163 | Norwegian (εγδβ)0 | N/A | NC_000011.10:g.5228098_5358569del | βLCR, ε, Aγ, Gγ, δ, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2167 | Asian Indian (εγδβ)0 | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
2419 | Senegalese δ(0)β(+) | N/A | NG_000007.3:g.(63154_63209)_(70570_70625)del7417 | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 0 |
2551 | Austrian I | N/A | N/A | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
3073 | Italian (εγδβ)0 deletion | N/A | NC_000011.10:g.[5194397_5357192del;5194356_5194401insAGCTAAAGGTTTTGTAAATGCACCAATCAGCAATCTGTGTCTAACTC] | ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
3340 | Brazilian (εγδβ)0 | N/A | NC_000011.10:g.(5106498_5151836)_(5324046_5390135)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β, OR51V1, OR51B2 | Causative | εγδβ-thalassaemia | NG_000007.3 | 0 |
3577 | 59 Kb deletion | N/A | NC_000011.10:g.5236469_5295261del | βLCR, ε, Aγ, Gγ | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 2355 |
3935 | 12.4 kb Mediterranean deletion | N/A | NG_000007.3:g.2798_15161delinsAGAGCCCT | βLCR | Causative | β-thalassaemia | NG_000007.3 | 2798 |
2165 | Puerto Rican (εγδβ)0 | N/A | NG_000007.3:g.2904_25432del | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 2904 |
2566 | Caribbean | N/A | NG_000007.3:g.8510_13369del | βLCR | Causative | β-thalassaemia | NG_000007.3 | 8510 |
3849 | ~72 kb εγδβ(0) del | N/A | NC_000011.10:g.(5200032_5215881)_(5288356_5295076)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 9260 |
2164 | Tennessean (εγδβ)0 | N/A | NG_000007.3:g.10054_21931del | βLCR | Causative | εγδβ-thalassaemia | NG_000007.3 | 10054 |
2479 | Toledo (1992 bp deletion) | N/A | NG_000007.3:g.11835_13826del | βLCR | Causative | β-thalassaemia | NG_000007.3 | 11835 |
3270 | Chinese I (εγδβ)0 | N/A | NC_000011.10:g.5036736_5270337del | ε, Aγ, Gγ, δ, β, pseudo β, OR51V1 | Causative | εγδβ-thalassaemia | NG_000007.3 | 27279 |
3868 | >35.3 Kb deletion | N/A | NG_000007.3:g.(21655_27675)_(63032_64586)del | ε, Aγ, Gγ, δ, pseudo β | Causative | εγδβ-thalassaemia | NG_000007.3 | 27675 |
3869 | >29.5 Kb duplication | N/A | NG_000007.3:g.(27675_41485)_(71150_72080)dup | Aγ, Gγ, δ, β, pseudo β | Causative | β-thalassaemia | NG_000007.3 | 41485 |
3835 | 78.9 kb Gγ(Aγδβ)0 del | N/A | NC_000011.10:g.5169895_5248821delins5216274_5216309 | Aγ, δ, β, pseudo β, OR52Z1-OR51V1 | Causative | δβ-thalassaemia | NG_000007.3 | 43875 |
1524 | Turkish (Aγδβ)0 | N/A | NG_000007.3:g.45410_81665del36256 | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 45410 |
1504 | SE Asian, Thai (Aγδβ)0 (HPFH-6) | N/A | NC_000011.10:g.5172745_5252029 | Aγ, δ, β, pseudo β, OR51V1, OR52Z1-OR51V1 | Causative | δβ-thalassaemia, Hb F levels | NG_000007.3 | 45587 |
1520 | German (Aγδβ)0 | N/A | NC_000011.10:g.(5197976_ 5198976)_(5251297_5251694)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 45922 |
1523 | Malaysian-2 (Aγδβ)0 | N/A | NC_000011.10:g.(5207467_5208467)_(5250061_5250240)del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 47376 |
1530 | Italian (Aγδβ)0 | N/A | NC_000011.10:g.5194458_5249516del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 48100 |
1527 | Chinese (Aγδβ)0 | N/A | NC_000011.10:g.5169918_5248821del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 48795 |
1526 | Black (Aγδβ)0 | N/A | NC_000011.10:g.5212727_5248576del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 49040 |
1506 | Indian (δβ)0 (32.6 kb GγΑγ(δβ)0 Indian del) | N/A | NC_000011.10:g.5214461_5247124del | δ, β, pseudo β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 50492 |
1508 | Japanese (δβ)0 | N/A | NC_000011.10:g.5132468_5246133del | δ, β, pseudo β | Causative | δβ-thalassaemia | NG_000007.3 | 51483 |
110 | IVS I-5 (G>A) + Corfu deletion (7.2 kb Corfu δβ thalassaemia, Corfu (δβ)0) | N/A | NG_000007.3:g.57237_64443del7207; HBB:c.92+5G>A | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 57237, 70691 |
1497 | Corfu (δ)0 (7.2kb Corfu deletion) | N/A | NG_000007.3:g.57237_64443del7207 | δ | Causative | δ-thalassaemia | NG_000007.3 | 57237 |
3971 | Tunisian (δβ)0 | N/A | NG_000007.3:g.58253_72837del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 58253 |
1509 | Spanish (δβ)0 | N/A | NG_000011.10:g.5144331_5237241del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 60375 |
1510 | Black (δβ)0 | N/A | NG_000007.3:g.(60530_60730)_(72351_72551)del11822 | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 60530 |
3601 | -130 A>G | N/A | HBD:c.-180A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 63003 |
3223 | CAP +48 (A>T) | N/A | HBD:c.-6A>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63019 |
2202 | CAP +53 (G>A) | N/A | HBD:c.-1G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63024 |
1321 | -80 (G>A) | N/A | HBD:c.-130G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63053 |
1322 | -77 T>C | N/A | HBD:c.-127T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63056 |
1323 | -76 (A>T) | N/A | HBD:c.-126A>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63057 |
1324 | -68 (C>T) | N/A | HBD:c.-118C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63065 |
1325 | -65 (A>G) | N/A | HBD:c.-115A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 63068 |
1326 | -55 (T>C) | N/A | HBD:c.-105T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63078 |
3602 | -44 G>A | N/A | HBD:c.-94G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63089 |
1327 | -36 (C>A) | N/A | HBD:c.-86C>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63097 |
1328 | -31 (A>G) | N/A | HBD:c.-81A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 63102 |
1329 | -30 T>C | N/A | HBD:c.-80T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63103 |
1330 | Init CD ATG>ATA [Met>Ile] | N/A | HBD:c.3G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63185 |
3307 | N/A | Hb Lepore Rochester-MN | NG_000007.3:g.[63191_70603dup;63291_70703del] | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 63191 |
3617 | CD 5 CCT>ACT [Pro>Thr] | Hb A2-Partinico | HBD:c.16C>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63198 |
3231 | CD 7 (-3bp): (-GAG) | N/A | HBD:c.22_24delGAG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63204 |
3336 | CD 7 GAG>TAG [Glu>STOP] | N/A | HBD:c.22G>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63204 |
3232 | CD 10 GCT>-CT | N/A | HBD:c.31delG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63213 |
4097 | CD 17 AAA>CAA [Lys>Gln] | Hb A2-Laibin | HBD:c.52A>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63234 |
3960 | CD 29 GGC>GGT [Gly>Gly] | N/A | HBD:c.90C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63272 |
1333 | CD 30 (AGG>ACG) | N/A | HBD:c.92G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63274 |
3883 | IVS I-1 G>C | N/A | HBD:c.92+1G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63275 |
1334 | IVS I-2 (T>C) | N/A | HBD:c.92+2T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63276 |
2090 | IVS I-5 G>T | N/A | HBD:c.92+5G>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63279 |
2563 | IVS I-1 (27 bp insertion) | N/A | HBD:c.92+83_84ins27 | δ | Causative | δ-thalassaemia | NG_000007.3 | 63357 |
3233 | IVS I 3' AG>-C | N/A | HBD:c.93-2delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63401 |
1335 | IVS I-128 G>C (IVS I 3' AG>AC) | N/A | HBD:c.93-1G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63402 |
1336 | CD 37 (TGG>TAG) | N/A | HBD:c.113G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63423 |
3806 | CD 44-48 (-CTTTGGGGATC) (p.Phe46Valfs*4) | N/A | HBD:c.135_145del | δ | Causative | δ-thalassaemia | NG_000007.3 | 63445 |
4026 | CD 46 GGG>CGG [Gly>Arg], IVS II-456 A>G | Hb A2-Malay | HBD:c.[139G>C;316-443A>G] | δ | Causative | δ-thalassaemia | NG_000007.3 | 63449, 64081 |
2575 | CD 58 +C | N/A | HBD:c.176_177insC | δ | Causative | δ-thalassaemia | NG_000007.3 | 63486 |
3441 | CD 59 AAG>A-G (δ0 59 (-A)) | N/A | HBD:c.179delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63489 |
3237 | CD 59/60 (+GG) | N/A | HBD:c.180_181dup | δ | Causative | δ-thalassaemia | NG_000007.3 | 63490 |
3870 | CD 62 GCT>CCT [Ala>Pro] | N/A | HBD:c.187G>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 63497 |
2092 | CD 82 AAG>TAG | N/A | NG_000007.3:g.63557A>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63557 |
3844 | CD 87 CAG>TAG [Gln>STOP] | N/A | HBD:c.262C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 63572 |
3236 | CD 87 CAG>C-G | N/A | HBD:c.263delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63573 |
1338 | CD 91 (+T) | N/A | HBD:c.275dupT | δ | Causative | δ-thalassaemia | NG_000007.3 | 63585 |
3598 | CD 93/94 (-TG) [Cys>STOP] | N/A | HBD:c.282_283delTG | δ | Causative | N/A | NG_000007.3 | 63592 |
3975 | CD 98 (-GTG, +A) | N/A | HBD:c.295_297delGTGinsA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63605 |
1340 | IVS II-1 G>A | N/A | HBD:c.315+1G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63626 |
1341 | IVS II-6 (T>A) | N/A | HBD:c.315+6T>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 63631 |
1507 | Sicilian (δβ)0 | N/A | NG_000007.3:g.64336_77738del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 64336 |
1512 | Laotian (δβ)0 (Thai (δβ)0-thal) | N/A | NG_000007.3:g.(64336_64524)_76866del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 64336 |
1513 | Thai/Vietnamese (δβ)0 (Thai (δβ)0 , Vietnamese (δβ)0 ) | N/A | NG_000007.3:g.64384_76993del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 64384 |
1342 | IVS II-894 C>T | N/A | HBD:c.316-5C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 64519 |
1343 | IVS II-897 A>C | N/A | HBD:c.316-2A>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 64522 |
2473 | IVS II-897 A>G | N/A | HBD:c.316-2A>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 64522 |
3234 | CD 113 (+TG) | N/A | HBD:c.341_342dupTG | δ | Causative | δ-thalassaemia | NG_000007.3 | 64549 |
3230 | CD 115 GCC>GTC [Ala>Val] | N/A | HBD:c.347C>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 64555 |
3229 | CD 116 CGC>GGC [Arg>Gly] | N/A | HBD:c.349C>G | δ | Causative | δ-thalassaemia | NG_000007.3 | 64557 |
3867 | >6.5 Kb deletion | N/A | NG_000007.3:g.(63032_64585)_(71150_72080)del | δ, β | Causative | δβ-thalassaemia | NG_000007.3 | 64585 |
3842 | CD134 GTG>GAG [Val>Glu] | N/A | HBD:c.404T>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 64612 |
3269 | CD 147 TGA>CGA [Stop>Arg] | N/A | HBD:c.442T>C | δ | Causative | δ-thalassaemia | NG_000007.3 | 64650 |
3394 | 223 kb deletion | N/A | NC_000011.10:g.5010012_5232933del | δ, β | Causative | β-thalassaemia | NG_000007.3 | 64683 |
1346 | Poly A +69 (G>A) | N/A | HBD:c.*199G>A | δ | Causative | δ-thalassaemia | NG_000007.3 | 64851 |
4033 | Poly A +69 (G>T) | N/A | HBD:c.*199G>T | δ | Causative | δ-thalassaemia | NG_000007.3 | 64851 |
3958 | 8.2 kb deletion | N/A | NG_000007.3:g.65147_73407del | β | Causative | β-thalassaemia | NG_000007.3 | 65147 |
298 | Filipino (~45 kb deletion) | N/A | NC_000011.10:g.5112882 _5231358del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66258 |
292 | Turk (~7.6 kb deletion) | N/A | NG_000007.3:g.[52524_60162del;66278_73952del] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66278 |
2283 | South-Italy | N/A | NC_000011.10:g.5164564_5230714del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66902 |
2157 | Indian (4056 bp deletion) | N/A | NG_000007.3:g.67357_71413del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 67357 |
3997 | 7.2 kb deletion | N/A | NC_000011.10:g.5222800_5230034del | β | Causative | β-thalassaemia | NG_000007.3 | 67582 |
296 | Dutch (12620 bp deletion) | N/A | NG_000007.3:g.68071_80682del12612 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 68071 |
2124 | Caucasian HPFH (27825 bp deletion) | N/A | NC_000011.10:g.5201455_5229279delins5223936_5223960 | β | Causative | β-thalassaemia, Hb F levels | NG_000007.3 | 68337 |
1505 | South East Asian (SEA) deletion (Vietnamese, SE Asian, HPFH-7, SEA-HPFH, 27 kb deletion) | N/A | NC_000011.10:g.5201647_5229059del | β | Causative | β-thalassaemia, Hb F levels | NG_000007.3 | 68557 |
3823 | 60 kb deletion (Prachinburi β0-thalassemia deletion) | N/A | NC_000011.10:g.5167971_5228123delinsA | β | Causative | β-thalassaemia | NG_000007.3 | 69493 |
289 | Croatian (1605 bp deletion) | N/A | NG_000007.3:g.69561_71164del1604 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69561 |
290 | Thai (3485 bp deletion, Chongqing deletion, NC_000011.10: g.5224303-5227790del, NC_000011.9: g.5245533_5249020del) | N/A | NG_000007.3:g.69826_73313del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69826 |
2150 | 1357 bp deletion (Taiwanese deletion) | N/A | NG_000007.3:g.69997_71353del1357 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69997 |
288 | Black, British (1393 bp deletion) | N/A | NG_000007.3:g.70060_71452del1393 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70060 |
2125 | Afghan (909 bp deletion) | N/A | NG_000007:g.70067_70976del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70067 |
284 | 468 bp deletion | N/A | NG_000007.3:g.70070_70537del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70070 |
285 | Black (532 bp deletion) | N/A | HBB:c.-504_28del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70091 |
3277 | 538 bp deletion | N/A | HBB:c.-464_74del | NG_000007.3:g.70131_70668del | β | Causative | β-thalassaemia | NG_000007.3 | 70131 |
3278 | 1517 bp deletion | N/A | HBB:c.-390_316-169delinsA | β | Causative | β-thalassaemia | NG_000007.3 | 70205 |
4066 | 10.8 kb deletion | N/A | NC_000011.10:g.5216601_5227407del | β | Causative | β-thalassaemia | NG_000007.3 | 70209 |
3081 | -223 T>C | N/A | HBB:c.-273T>C | β | Causative | β-thalassaemia | NG_000007.3 | 70322 |
3562 | -198 A>G | N/A | HBB:c.-248A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70347 |
1 | -190 (G>A) | N/A | HBB:c.-240G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70355 |
2122 | 125 bp deletion | N/A | NG_000007.3:g.70360_70485del125 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70360 |
2153 | Kabylia deletion/insertion | N/A | NG_000007.3:g.70417_72458delinsATAAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70417 |
283 | 290 bp deletion | N/A | HBB:c.-176_92+25del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70419 |
2 | -102 (C>A) | N/A | HBB:c.-152C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70443 |
3 | -101 (C>T) | N/A | HBB:c.-151C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
4 | -101 (C>G) | N/A | HBB:c.-151C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
3752 | -99 to -85 (-15bp) | N/A | HBB:c.-149_-135delGTGGAGCCACACCCT | β | Causative | β-thalassaemia | NG_000007.3 | 70446 |
3059 | -98 T>A | N/A | HBB:c.-148T>A | β | Causative | β-thalassaemia | NG_000007.3 | 70447 |
5 | -93 C>G | N/A | HBB:c.-143C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70452 |
6 | -92 (C>T) | N/A | HBB:c.-142C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70453 |
7 | -90 (C>T) | N/A | HBB:c.-140C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
3224 | -90 (C>G) | N/A | HBB:c.-140C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
3990 | -89 to -88 (-AC) | N/A | HBB:c.-139_-138delAC | β | Causative | β-thalassaemia | NG_000007.3 | 70456 |
8 | -88 (C>T) | N/A | HBB:c.-138C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
9 | -88 (C>A) | N/A | HBB:c.-138C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
2178 | -88 C>G | N/A | HBB:c.-138C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
10 | -87 C>G | N/A | HBB:c.-137C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
11 | -87 (C>T) | N/A | HBB:c.-137C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
12 | -87 (C>A) | N/A | HBB:c.-137C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
13 | -86 C>G | N/A | HBB:c.-136C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
14 | -86 (C>A) | N/A | HBB:c.-136C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
4028 | -86 C>T | N/A | HBB:c.-136C>T | β | Causative | β-thalassaemia | NG_000007.3 | 70459 |
3077 | -83 G>A | N/A | HBB:c.-133G>A | β | Causative | β-thalassaemia | NG_000007.3 | 70462 |
3069 | -77 G>C | N/A | HBB:c.-127G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70468 |
3386 | -76 C>A | N/A | HBB:c.-126C>A | β | Causative | β-thalassaemia | NG_000007.3 | 70469 |
3671 | -76 C>T | N/A | HBB:c.-126C>T | β | Causative | β-thalassaemia | NG_000007.3 | 70469 |
15 | -73 (A>T) | N/A | HBB:c.-123A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70472 |
3672 | -73 A>C | N/A | HBB:c.-123A>C | β | Causative | β-thalassaemia | NG_000007.3 | 70472 |
3673 | -73 A>G | N/A | HBB:c.-123A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70472 |
2997 | -72 T>A | N/A | HBB:c.-122T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70473 |
2171 | -71 C>T | N/A | HBB:c.-121C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70474 |
3674 | -63 A>G | N/A | HBB:c.-113A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70482 |
16 | -56 G>C | N/A | HBB:c.-106G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70489 |
17 | -50 G>A | N/A | HBB:c.-100G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70495 |
3060 | -42 C>G | N/A | HBB:c.-92C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70503 |
3925 | -42 (-C) | N/A | HBB:c.-92delC | β | Causative | β-thalassaemia | NG_000007.3 | 70503 |
2172 | -41 A>T | N/A | HBB:c.-91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70504 |
18 | -32 (C>A) | N/A | HBB:c.-82C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
19 | -32 (C>T) | N/A | HBB:c.-82C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
20 | -31 (A>G) | N/A | HBB:c.-81A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
21 | -31 (A>C) | N/A | HBB:c.-81A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
22 | -30 (T>A) | N/A | HBB:c.-80T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
23 | -30 (T>C) | N/A | HBB:c.-80T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
2179 | -30 T>G | N/A | HBB:c.-80T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
3062 | -30 (-T) | N/A | HBB:c.-80delT | β | Causative | β-thalassaemia | NG_000007.3 | 70515 |
24 | -29 to -26 (-AA) | N/A | HBB:c.-79_78delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
25 | -29 (A>G) | N/A | HBB:c.-79A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
26 | -29 (A>C) | N/A | HBB:c.-79A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
28 | -28 (A>C) | N/A | HBB:c.-78A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70517 |
29 | -28 (A>G) | N/A | HBB:c.-78A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70517 |
30 | -27 (A>T) | N/A | HBB:c.-77A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
31 | -27 (-AA) | N/A | HBB:c.-77_-76delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
2175 | -26 A>C | N/A | HBB:c.-76A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70519 |
32 | -25 (G>C) | N/A | HBB:c.-75G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70520 |
2565 | -25 G>T | N/A | HBB:c.-75G>T | β | Causative | β-thalassaemia | NG_000007.3 | 70520 |
282 | 105 bp deletion | N/A | HBB:c.-74_31del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70521 |
3926 | -17 (A>G) | N/A | HBB:c.-67A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70528 |
34 | CAP +1 (A>C) | N/A | HBB:c.-50A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70545 |
3464 | CAP +3 A>T | N/A | HBB:c.-48A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70547 |
35 | CAP +8 (C>T) | N/A | HBB:c.-43C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70552 |
36 | CAP +10 (-T) (5'UTR +10 (-T)) | N/A | HBB:c.-41delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70554 |
3627 | CAP +20 (-C) | N/A | HBB:c.-31delC | β | Causative | β-thalassaemia | NG_000007.3 | 70564 |
38 | CAP +22 (G>A) | N/A | HBB:c.-29G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
3345 | CAP +22 (G>T) | N/A | HBB:c.-29G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
3676 | CAP +27 (C>G) | N/A | HBB:c.-24C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70571 |
33 | -22 to +23 (+45 bp duplication) | N/A | NG_000007.3:g.70573_70617dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70573 |
2536 | CAP +30 T>A | N/A | HBB:c.-21T>A | β | Causative | β-thalassaemia | NG_000007.3 | 70574 |
4089 | CAP +32 (G>C) | N/A | HBB:c.-19G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70576 |
39 | CAP +33 (C>G) | N/A | HBB:c.-18C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70577 |
2176 | CAP +39 C>T | N/A | HBB:c.-12C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70583 |
40 | CAP +41 to +44 (-AACA) (CAP +40 to +43 (-AAAC)) | N/A | HBB:c.-10_-7delAACA | β | Causative | β-thalassaemia | NG_000007.3 | 70585 |
41 | CAP +45 (G>C) | Hb Odisha | HBB:c.-6G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70589 |
42 | Init CD ATG>GTG | N/A | HBB:c.1A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
43 | Init CD ATG>CTG | N/A | HBB:c.1A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
44 | Init CD ATG>ACG | N/A | HBB:c.2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
45 | Init CD ATG>AGG | N/A | HBB:c.2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
46 | Init CD ATG>AAG | N/A | HBB:c.2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
47 | Init CD ATG>ATC | N/A | HBB:c.3G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
48 | Init CD ATG>ATA | N/A | HBB:c.3G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
49 | Init CD ATG>ATT | N/A | HBB:c.3G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
50 | CD 1 (-G) | N/A | HBB:c.4delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70598 |
51 | CD 2-4 (-9 bp, +31 bp) | N/A | HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3014 | CD 2 CAT>C-T | N/A | HBB:c.8delA | β | Causative | β-thalassaemia | NG_000007.3 | 70602 |
3561 | CD 2 CAT/CA- | N/A | HBB:c.9delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603 |
52 | CD 3 (+T) | N/A | HBB:c.11dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70605 |
3817 | CD 4 (-T) | N/A | HBB:c.14delC | β | Causative | β-thalassaemia | NG_000007.3 | 70608 |
55 | CD 4/5/6: CD 4 (ACT>ACA), CD 5 (CCT>TCT), CD 6 (GAG>TAG) | N/A | HBB:c.[15T>A;16C>T;19G>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70609, 70610, 70613 |
54 | CD 5 -CT | N/A | HBB:c.17_18delCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70611 |
2180 | CD 5/6 -TG | N/A | HBB:c.18_19delTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70612 |
56 | CD 6 (GAG>TAG) | N/A | HBB:c.19G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
2184 | CD 6-14 (-26 bp) (26 bp deletion) | N/A | HBB:c.20_45del26bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
57 | CD 6 -A | N/A | HBB:c.20delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
58 | CD 6 (-G) | N/A | HBB:c.20delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
59 | CD 6-10 (-13 bp) | N/A | HBB:c.21_33delGGAGAAGTCTGCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70615 |
60 | CD 7 GAG>TAG | N/A | HBB:c.22G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70616 |
3288 | CD7 GAG>G-G | N/A | HBB:c.23delA | β | Causative | β-thalassaemia | NG_000007.3 | 70617 |
2958 | CD 7/8 (+G) | N/A | HBB:c.24dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70618 |
61 | CD 8 (-AA) | N/A | HBB:c.25_26delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70619 |
2185 | CD 8/9 +AGAA | N/A | HBB:c.27_28insAGAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70620 |
62 | CD 8/9 (+G) | N/A | HBB:c.27dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
3513 | CD 8 AAG>AA- | N/A | HBB:c.27delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
63 | CD 9 (+TA) | N/A | HBB:c.28_29insTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70622 |
4108 | CD 10 GCC>GTC [Ala>Val] | N/A | HBB:c.31_32insT | β | Causative | β-thalassaemia | NG_000007.3 | 70625 |
65 | CD 10 GCC>GCA [Ala>Ala] | N/A | HBB:c.33C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
66 | CD 10 (-C) | N/A | HBB:c.33delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
67 | CD 11 (-T) | N/A | HBB:c.36delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70630 |
3721 | CD 14 CTG>-TG | N/A | HBB:c.43delC | β | Causative | β-thalassaemia | NG_000007.3 | 70637 |
68 | CD 14 (+T) | N/A | HBB:c.44dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
2553 | CD 14 CTG>C-G | N/A | HBB:c.44delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
69 | CD 14/15 (+G) | N/A | HBB:c.45dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70639 |
70 | CD 15 (-T) | N/A | HBB:c.46delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70640 |
72 | CD 15 TGG>TAG | N/A | HBB:c.47G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70641 |
73 | CD 15 TGG>TGA | N/A | HBB:c.48G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70642 |
71 | CD 15/16 (+G) | N/A | HBB:c.50dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
74 | CD 15/16 (-G) | N/A | HBB:c.50delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
75 | CD 16 GGC>GG- | N/A | HBB:c.51delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
76 | CD 16 GGC>GGT [Gly>Gly] | N/A | HBB:c.51C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
77 | CD 17 AAG>TAG [Lys>STOP] | N/A | HBB:c.52A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70646 |
78 | CD 17 (+A) | N/A | HBB:c.53dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70647 |
3609 | CD 20/21 (-TGGA) | N/A | HBB:c.62_65delTGGA | β | Causative | β-thalassaemia | NG_000007.3 | 70656 |
80 | CD 20-22 (GTGGATGAA>GTGAA) | N/A | HBB:c.64_67del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
81 | CD 20/21 (+G) | N/A | HBB:c.64dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
83 | CD 22 (GAA>TAA) | N/A | HBB:c.67G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70661 |
84 | CD 22-24 ( -7 bp): (-AAGTTGG) | N/A | HBB:c.68_74delAAGTTGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70662 |
85 | CD 24 (-G, +CAC) | N/A | HBB:c.74delinsCAC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
2174 | CD 24 -G | N/A | HBB:c.74delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
86 | CD 24 GGT>GGA [Gly>Gly] | N/A | HBB:c.75T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70669 |
281 | IVS I [3 end] -44 bp (44 bp deletion) | N/A | HBB:c.76_92+27del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70670 |
87 | CD 25/26 (+T) | N/A | HBB:c.78dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70672 |
89 | CD 26 (GAG>TAG) | N/A | HBB:c.79G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
90 | CD 26 (+T) | N/A | HBB:c.79_80insT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
92 | CD 27/28 (+C) | N/A | HBB:c.85dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
93 | CD 28 (-C) | N/A | HBB:c.85delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
95 | CD 28/29 (-G) | N/A | HBB:c.89delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70683 |
96 | CD 29 (C>T) or IVS I (-3) GGC>GGT (Gly>Gly) | N/A | HBB:c.90C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70684 |
97 | CD 30 (A>G) or IVS I (-2) AGG>GGG (Arg>Gly) | N/A | HBB:c.91A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
98 | CD 30 (A>C) or IVS I (-2) AGG>CGG [Arg>Arg] | N/A | HBB:c.91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
3484 | CD 30 (-A) or IVS I (-2) AGG>-GG | N/A | HBB:c.91delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
99 | CD 30 (G>A) or IVS I (-1) AGG>AAG (Arg>Lys) | N/A | HBB:c.92G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
101 | IVS I-1 G>A | N/A | HBB:c.92+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
102 | IVS I-1 (G>T) | N/A | HBB:c.92+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
103 | IVS I-1 (G>C) | N/A | HBB:c.92+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
104 | IVS I-2 (T>G) | N/A | HBB:c.92+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
105 | IVS I-2 (T>C) | N/A | HBB:c.92+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
106 | IVS I-2 (T>A) | N/A | HBB:c.92+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
107 | IVS I-5 (G>C) | N/A | HBB:c.92+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
108 | IVS I-5 (G>T) | N/A | HBB:c.92+5G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
109 | IVS I-5 (G>A) | N/A | HBB:c.92+5G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
111 | IVS I-6 (T>C) | N/A | HBB:c.92+6T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
3565 | IVS I-6 (T>G) | N/A | HBB:c.92+6T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
112 | IVS I-7 A>T | N/A | HBB:c.92+7A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
3276 | IVS I-7 A>G | N/A | HBB:c.92+7A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
3690 | IVS I-65 (G>A) | N/A | HBB:c.92+65G>A | β | Causative | β-thalassaemia | NG_000007.3 | 70751 |
3066 | IVS I-108 T>C | N/A | HBB:c.93-23T>C | β | Causative | β-thalassaemia | NG_000007.3 | 70794 |
280 | IVS I [3' end] (-25 bp) (25 bp deletion) | N/A | NC_000011.10(NM_000518.4):c.93-22_95del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
2173 | IVS I-109 (-T) | N/A | HBB:c.93-22delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
113 | IVS I-110 G>A | N/A | HBB:c.93-21G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70796 |
121 | IVS I [3' end] (-17 bp) (17 bp deletion) | N/A | HBB:c.93-17_93-1delTATTTTCCCACCCTTAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70800 |
3008 | IVS I-115 (A>T) | N/A | HBB:c.93-16A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70801 |
114 | IVS I-116 (T>G) | N/A | HBB:c.93-15T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70802 |
124 | IVS I [3' end] (+22bp) | N/A | NG_000007.3:g.70807_70828dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70807 |
115 | IVS I-128 (T>G) | N/A | HBB:c.93-3T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70814 |
116 | IVS I-129 (A>C) | N/A | HBB:c.93-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
117 | IVS I-129 (A>G) | N/A | HBB:c.93-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
4067 | IVS I-129 (A>T) | N/A | HBB:c.93-2A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70815 |
118 | IVS I-130 G>C | N/A | HBB:c.93-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
119 | IVS I-130 (G>A) | N/A | HBB:c.93-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
120 | IVS I-130 (+1) or CD 30, (G>C); AGG>AGC (Arg>Ser) | Hb Tacoma II | HBB:c.93G>C | β | Causative | β-thalassaemia | NG_000007.3 | 70817 |
126 | CD 31 (-C) | N/A | HBB:c.94delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70818 |
130 | CD 33-34 (-G) | N/A | HBB:c.102_103delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
132 | CD 35 TAC>TGC [Tyr>Cys] | N/A | HBB:c.107A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70831 |
133 | CD 35 TAC>TAA | N/A | HBB:c.108C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70832 |
3023 | CD 35 TAC>TAG | N/A | HBB:c.108C>G | β | Causative | β-thalassaemia | NG_000007.3 | 70832 |
3692 | CD 35 (TAC>TA-) | N/A | HBB:c.108delC | β | Causative | β-thalassaemia | NG_000007.3 | 70832 |
128 | CD 36 CCT>C-T (CD 36 (-C)) | N/A | HBB:c.110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70834 |
135 | CD 36-39 (-8 bp) | N/A | HBB:c.111_118delTTGGACCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70835 |
134 | CD 36/37 (-T) | N/A | HBB:c.112delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70836 |
138 | CD 37 (TGG>TAG) | N/A | HBB:c.113G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70837 |
136 | CD 37 (-G) | N/A | HBB:c.114delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
137 | CD 37 (TGG>TGA) | N/A | HBB:c.114G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
139 | CD 37-39 (-7 bp): (-GACCCAG) | N/A | HBB:c.114_120del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
141 | CD 38/39 (-CC) | N/A | HBB:c.117_118delCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70841 |
140 | CD 38/39 (-C) | N/A | HBB:c.118delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
142 | CD 39 CAG>TAG [Gln>STOP] | N/A | HBB:c.118C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
2393 | CD 39 -A | N/A | HBB:c.119delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70843 |
143 | CD 40 (-G) | N/A | HBB:c.123delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
144 | CD 40 (+86 bp) (HGSA) | N/A | HBB:c.123_208dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
145 | CD 40/41 (+T) | N/A | HBB:c.125dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70849 |
146 | CD 41 (-C) | N/A | HBB:c.126delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
147 | CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT)) | N/A | HBB:c.126_129delCTTT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
148 | CD 42/43 (+T) | N/A | HBB:c.129dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70853 |
149 | CD 42/43 (+G) | N/A | HBB:c.130dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
150 | CD 43 (GAG>TAG) | N/A | HBB:c.130G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
3594 | CD 43 (GAG>TAG);CD 71/72 (+A) | N/A | HBB:c.[130G>T;217dupA] | β | Causative | β-thalassaemia | NG_000007.3 | 70854, 70941 |
151 | CD 44 -C | N/A | HBB:c.135delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70859 |
152 | CD 45 (-T) | N/A | HBB:c.138delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
153 | CD 45 (+T) | N/A | HBB:c.138dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
154 | CD 45/46 (+A) | N/A | HBB:c.138_139insA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
2960 | CD 46/47 (+G) | N/A | HBB:c.142_142dupG | β | Causative | β-thalassaemia | NG_000007.3 | 70866 |
155 | CD 47 (+A) | N/A | HBB:c.143dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
156 | CD 47/48 (+ATCT) | N/A | HBB:c.143_146dupATCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
2187 | CD 48 -T | N/A | HBB:c.146delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70870 |
157 | CD 49 (-C) | N/A | HBB:c.150delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70874 |
3571 | CD 50 ACT>GCT [Thr>Ala] | N/A | HBB:c.151A>G | β | Causative | β-thalassaemia | NG_000007.3 | 70875 |
158 | CD 50 (-T) | N/A | HBB:c.153delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70877 |
159 | CD 51 (-C) | N/A | HBB:c.155delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70879 |
2959 | CD 52 GAT>G-T | N/A | HBB:c.158delA | β | Causative | β-thalassaemia | NG_000007.3 | 70882 |
160 | CD 53 (-T) | N/A | HBB:c.162delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70886 |
161 | CD 53/54 (+G) | N/A | HBB:c.163dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70887 |
4094 | CD 54 GTT>-TT | N/A | HBB:c.163del | β | Causative | β-thalassaemia | NG_000007.3 | 70887 |
162 | CD 54 -T | N/A | HBB:c.165delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
164 | CD 54-58 (-13bp) | N/A | HBB:c.165_177delTATGGGCAACCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
163 | CD 54/55 (+A) | N/A | HBB:c.166dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
165 | CD 55 (-A) | N/A | HBB:c.166delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
2990 | CD 55-59 (-13 bp) | N/A | HBB:c.167_179del | β | Causative | β-thalassaemia | NG_000007.3 | 70891 |
166 | CD 56-60 (+14 bp) | N/A | HBB:c.170_183dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70894 |
167 | CD 58 (+C) | N/A | HBB:c.176dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70900 |
3311 | CD 58 CCT>C-T | N/A | HBB:c.176delC | β | Causative | β-thalassaemia | NG_000007.3 | 70900 |
169 | CD 59 (AAG>TAG) | N/A | HBB:c.178A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70902 |
3061 | CD 59 (+T) | N/A | HBB:c.178_179insT | β | Causative | β-thalassaemia | NG_000007.3 | 70902 |
168 | CD 59 -A | N/A | HBB:c.179delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70903 |
4086 | CD 59 AAG>AA-, CD 59 (-G) | N/A | HBB:c.180del | β | Causative | β-thalassaemia | NG_000007.3 | 70904 |
3855 | CD 60 GTG>-TG [Val>STOP] | N/A | HBB:c.181delG | β | Causative | β-thalassaemia | NG_000007.3 | 70905 |
172 | CD 61 (AAG>TAG) | N/A | HBB:c.184A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70908 |
2190 | CD 62-83 (+65 bp) | N/A | HBB:c.187_251dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70911 |
3589 | CD 62-65 (-12bp) | N/A | HBB:c.187_198delGCTCATGGCAAG | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 70911 |
171 | CD 62-64 (-7bp) | N/A | HBB:c.189_195delTCATGGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70913 |
173 | CD 64 (-G) | N/A | HBB:c.194delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70918 |
3944 | CD 64 (+G) | N/A | HBB:c.194dup | β | Causative | β-thalassaemia | NG_000007.3 | 70918 |
174 | CD 66 AAA>TAA [Lys>STOP] | N/A | HBB:c.199A>T | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
3854 | CD 66/67 (-AAAG) | N/A | HBB:c.199_202delAAAG | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
2188 | CD 66 -A | N/A | HBB:c.201delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70925 |
175 | CD 67 (-TG) | N/A | HBB:c.203_204delGT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70927 |
3019 | CD 68-70 (-7bp): (-TCGGTGC) | N/A | HBB:c.206_212delTCGGTGC | β | Causative | β-thalassaemia | NG_000007.3 | 70930 |
2522 | CD 69 GGT>G-T | N/A | HBB:c.209delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70933 |
2189 | CD 69 -T | N/A | HBB:c.210delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70934 |
176 | CD 71 (+T) | N/A | HBB:c.216dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70940 |
2462 | CD 71 -T | N/A | HBB:c.216delT | β | Causative | β-thalassaemia | NG_000007.3 | 70940 |
177 | CD 71/72 (+A) | N/A | HBB:c.217dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
178 | CD 72-73 (-AGTGA, +T) | N/A | HBB: c.217_221delAGTGAinsT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
2181 | CD 72/73 (+T) | N/A | HBB:c.219dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70943 |
3374 | CD 72 AGT>AGA [Ser>Arg]; CD 73 GAT>TAT [Asp>Tyr] | Hb South China | HBB:c.[219T>A;220G>T] | β | Causative | β-thalassaemia | NG_000007.3 | 70943, 70944 |
179 | CD 75 (-C) | N/A | HBB:c.226delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70950 |
180 | CD 76 GCT>--T (-GC) | N/A | HBB:c.229_230delGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70953 |
181 | CD 76 (-C) | N/A | HBB:c.230delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70954 |
182 | CD 78 CTG>-TG | N/A | HBB:c.235delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70959 |
3299 | CD 77/78 (+C) | N/A | HBB:c.235dupC | β | Causative | β-thalassaemia | NG_000007.3 | 70959 |
3225 | CD 78/85 (-20bp) | N/A | HBB:c.237_256delGGACAACCTCAAGGGCACCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70961 |
183 | CD 80/81 (-C) | N/A | HBB:c.244delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
184 | CD 81-87 (-22 bp) | N/A | HBB:c.244_265del22 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
185 | CD 82/83 (-G) | N/A | HBB:c.251delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70975 |
186 | CD 84-86 (-8 bp): (-CACCTTTG) | N/A | HBB:c.253_260del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70977 |
187 | CD 84/85 (+C) | N/A | HBB:c.255dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70979 |
188 | CD 84-86 (+T) | N/A | HBB:c.258dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70982 |
3722 | CD 86 GCC>GC- | N/A | HBB:c.261delC | β | Causative | β-thalassaemia | NG_000007.3 | 70985 |
4044 | CD 87-91 (-14 bp) | N/A | HBB:c.263_276del | β | Causative | β-thalassaemia | NG_000007.3 | 70987 |
3253 | CD 88 CTG>--G (HBB:c.265_266delCT) | N/A | HBB:c.265_266del | β | Causative | β-thalassaemia | NG_000007.3 | 70989 |
189 | CD 88 (+T) | N/A | HBB:c.266dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
190 | CD 88 (-TG) | N/A | HBB:c.266_267del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
3287 | CD 89-93 (-14bp): (-AGTGAGCTGCACTG) | N/A | HBB:c.268_281delAGTGAGCTGCACTG | β | Causative | β-thalassaemia | NG_000007.3 | 70992 |
191 | CD 89/90 (AGTGAG>AGAG) | N/A | HBB:c.270_271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70994 |
192 | CD 90 GAG>TAG | N/A | HBB:c.271G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70995 |
3044 | CD 90 GAG>-AG | N/A | HBB:c.271delG | β | Causative | β-thalassaemia | NG_000007.3 | 70995 |
3057 | CD 90 (+24 bp) (+AGCTGCACTGTGACAAGCTGCACG) | N/A | HBB:c.272_295dup | β | Causative | β-thalassaemia | NG_000007.3 | 70996 |
3133 | IVS II-1 G>A and CD 91 CTG>TTG [Leu>Leu] | N/A | HBB:c.[315+1G>A; 274C>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70998, 71040 |
194 | CD 91 (+T) | N/A | HBB:c.275dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
196 | CD 95 (+A) | N/A | HBB:c.287dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71011 |
3888 | CD 97/98 (+GCAC) | N/A | HBB:c.291_294dup | β | Causative | β-thalassaemia | NG_000007.3 | 71015 |
2279 | CD 102 AAC>ATCAC | N/A | HBB:c.308insTC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71032 |
3636 | CD 104 (-A) | N/A | HBB:c.313delA | β | Causative | β-thalassaemia | NG_000007.3 | 71037 |
199 | IVS II-1 (-G) | N/A | HBB:c.315+1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
200 | IVS II-1 G>A | N/A | HBB:c.315+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
201 | IVS II-1 G>C | N/A | HBB:c.315+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
202 | IVS II-1 G>T | N/A | HBB:c.315+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
203 | IVS II-2 T>C | N/A | HBB:c.315+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
204 | IVS II-2 (T>A) | N/A | HBB:c.315+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
205 | IVS II-2 (-T) | N/A | HBB:c.315+2del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
206 | IVS II-2/3 (-2 bp, +11 bp) (IVS II-2,3 (+11/-2)) | N/A | HBB:c.315+2_315+3delinsACGTTCTCTGA | β | Causative | β-thalassaemia | NG_000007.3 | 71041 |
2182 | IVS II-2 -TGAGTCTATGGG | N/A | HBB:c.315+2_315+13delTGAGTCTATGGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
3226 | IVS II-2 T>G | N/A | HBB:c.315+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
207 | IVS II 4/5 -AG | N/A | NG_000007.3:g.71043_71044delAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71043 |
208 | IVS II-5 (G>C) | N/A | HBB:c.315+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71044 |
3677 | IVS II-15 (C>T) | N/A | HBB:c.315+15C>T | β | Causative | β-thalassaemia | NG_000007.3 | 71054 |
3678 | IVS II-45 (A>G) | N/A | HBB:c.315+45A>G | β | Causative | β-thalassaemia | NG_000007.3 | 71084 |
3681 | IVS II-63 (T>C) | N/A | HBB:c.315+63T>C | β | Causative | β-thalassaemia | NG_000007.3 | 71102 |
3680 | IVS II-70 (G>A) | N/A | HBB:c.315+70G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71109 |
3679 | IVS II-129 (G>A) | N/A | HBB:c.315+129G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71168 |
3977 | IVS II-132 G>C | N/A | HBB:c.315+132G>C | β | Causative | β-thalassaemia | NG_000007.3 | 71171 |
4040 | IVS II-143 G>A | N/A | HBB:c.315+143G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71182 |
3682 | IVS II-180 (T>C) | N/A | HBB:c.315+180T>C | β | Causative | β-thalassaemia | NG_000007.3 | 71219 |
3683 | IVS II-308 (-A) | N/A | HBB:c.315+308delA | β | Causative | β-thalassaemia | NG_000007.3 | 71347 |
4046 | IVS II-337 A>G | N/A | HBB:c.315+337A>G | β | Causative | β-thalassaemia | NG_000007.3 | 71376 |
3996 | 4.9 Kb deletion (NG_000007.3:g.71429_76331del) | N/A | NC_000011.10:g.5226187_5231089del | β | Causative | β-thalassaemia, Ineffective erythropoiesis | NG_000007.3 | 71429 |
3797 | IVS II-509 (-A) | N/A | HBB:c.316-342delA | β | Causative | β-thalassaemia | NG_000007.3 | 71548 |
286 | 619 bp deletion (Asian Indian) | N/A | NG_000007.3:g.71609_72227del619 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71609 |
210 | IVS II-613 (C>T) | N/A | HBB:c.316-238C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71652 |
3391 | IVS II-648/649 (-T) | N/A | HBB:c.316-202del | β | Causative | β-thalassaemia | NG_000007.3 | 71688 |
211 | IVS II-654 C>T | N/A | HBB:c.316-197C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71693 |
3866 | IVS II-659_664 (-GCAATA) | N/A | HBB:c.316-192_187del | β | Causative | β-thalassaemia | NG_000007.3 | 71698 |
3686 | IVS II-672 (A>C) | N/A | HBB:c.316-179A>C | β | Causative | β-thalassaemia | NG_000007.3 | 71711 |
212 | IVS II-705 (T>G) | N/A | HBB:c.316-146T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71744 |
3796 | IVS II-716 (+T) | N/A | HBB:c.316-135dupT | β | Causative | β-thalassaemia | NG_000007.3 | 71755 |
213 | IVS II-726 A>G | N/A | HBB:c.316-125A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71765 |
214 | IVS II-745 C>G | N/A | HBB:c.316-106C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71784 |
3928 | IVS II-752 T>G | N/A | HBB:c.316-99T>G | β | Causative | β-thalassaemia | NG_000007.3 | 71791 |
2200 | IVS II-765 L1 insertion (+CTGCTTTTATTTT) | N/A | HBB:c.316-98_316-86dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71792 |
215 | IVS II-761 A>G | N/A | HBB:c.316-90A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71800 |
2183 | IVS II-781 C>G | N/A | HBB:c.316-70C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71820 |
4088 | IVS II-786 T>A | N/A | HBB:c.316-65T>A | β | Causative | β-thalassaemia | NG_000007.3 | 71825 |
3687 | IVS II-806 (G>C) | N/A | HBB:c.316-45G>C | β | Causative | β-thalassaemia | NG_000007.3 | 71845 |
3616 | IVS II-809 (-G) | N/A | HBB:c.316-42delG | β | Causative | β-thalassaemia | NG_000007.3 | 71848 |
216 | IVS II-815 (C>T) | N/A | HBB:c.316-36C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71854 |
3558 | IVS II-821 (A>C) | N/A | HBB:c.316-30A>C | β | Causative | β-thalassaemia | NG_000007.3 | 71860 |
217 | IVS II-837 (T>G) | N/A | HBB:c.316-14T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71876 |
218 | IVS II-843 (T>G) | N/A | HBB:c.316-8T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71882 |
219 | IVS II-844 (C>A) | N/A | HBB:c.316-7C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
220 | IVS II-844 (C>G) | N/A | HBB:c.316-7C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
221 | IVS II-848 (C>A) | N/A | HBB:c.316-3C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
222 | IVS II-848 (C>G) | N/A | HBB:c.316-3C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
3045 | IVS II-848 C>T | N/A | HBB: c.316-3C>T | β | Causative | β-thalassaemia | NG_000007.3 | 71887 |
223 | IVS II-849 (A>G) | N/A | HBB:c.316-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
224 | IVS II-849 (A>C) | N/A | HBB:c.316-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
225 | IVS II-850 G>C | N/A | HBB:c.316-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
226 | IVS II-850 (G>A) | N/A | HBB:c.316-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
227 | IVS II-850 (G>T) | N/A | HBB:c.316-1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
228 | IVS II-850 (-G) | N/A | HBB:c.316-1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
231 | CD 107 (+G) | N/A | HBB:c.323dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
2191 | CD 107-111 (-12 bp): (-GCAACGTGCTGG) | N/A | HBB:c.323_334del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
4064 | CD109/110 (-GCT +CAGCACGATG) | N/A | HBB:c.330_332delinsCAGCACGATG | β | Causative | β-thalassaemia | NG_000007.3 | 71904 |
3024 | CD 111-115 (-12bp): (-TCTGTGTGCTGG) | N/A | HBB:c.335_346del | β | Causative | β-thalassaemia | NG_000007.3 | 71909 |
4075 | CD 111/112 (+C) | N/A | HBB:c.336dup | β | Causative | β-thalassaemia | NG_000007.3 | 71910 |
235 | CD 112 (TGT>TGA) | N/A | HBB:c.339T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
2192 | CD 114/115 (+TGTGCTG) | N/A | HBB:c.339_345dupTGTGCTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
3750 | CD 115 GCC>ACC [Ala>Thr] | N/A | HBB:c.346G>A | β | Causative | β-thalassaemia | NG_000007.3 | 71920 |
240 | CD 116 (+TGAT) | N/A | HBB:c.349_350insTGAT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71924 |
3846 | CD 118 (-TT) | N/A | HBB:c.356_357delTT | β | Causative | β-thalassaemia | NG_000007.3 | 71930 |
3555 | CD 124 (+C) | N/A | HBB:c.374dup | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 71948 |
4065 | CD 124 (-C) | N/A | HBB:c.374delC | β | Causative | α-thalassaemia | NG_000007.3 | 71948 |
2194 | CD 124/125 (+A) | N/A | HBB:c.375dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
2195 | CD 125-127 (-CAGTGC) | N/A | HBB:c.377_382delCAGTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71951 |
3563 | CD 126 GTG>-TG | N/A | HBB:c.379delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71953 |
4087 | CD 128-134 (-21bp): (-CAGGCTGCCTATCAGAAAGTG) | N/A | HBB:c.382_402del | β | Causative | β-thalassaemia | NG_000007.3 | 71956 |
3927 | CD 128 GCT>-CT | N/A | HBB:c.385delG | β | Causative | β-thalassaemia | NG_000007.3 | 71959 |
2196 | CD 130 TAT>TAA [Tyr>STOP] | N/A | HBB:c.393T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71967 |
3860 | CD 130 TAT>TAG [Tyr>STOP] | N/A | HBB:c.393T>G | β | Causative | β-thalassaemia | NG_000007.3 | 71967 |
258 | CD 131 (CAG>TAG) | N/A | HBB:c.394C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71968 |
2197 | CD 131 (+A) | N/A | HBB:c.395dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71969 |
259 | CD 131/132 (+GCCT) | N/A | HBB:c.396_397insGCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
262 | CD 132 (AAA>TAA) | N/A | HBB:c.397A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71971 |
3896 | CD 132 (AAA>AA-) | N/A | HBB:c.399del | β | Causative | β-thalassaemia | NG_000007.3 | 71973 |
3361 | CD 138/139 (+T) | N/A | HBB:c.417dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71991 |
4104 | CD 147 TAA>ΑAC [Stop>Tyr] | N/A | HBB:c.444A>C | β | Causative | β-thalassaemia | NG_000007.3 | 72018 |
3863 | 3'UTR +1 G>A | N/A | HBB:c.*1G>A | β | Causative | β-thalassaemia | NG_000007.3 | 72019 |
267 | 3'UTR +6 C>G (Terminal CD +6 C>G, CAP +1480, β nt 1480 C>G) | N/A | HBB:c.*6C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72024 |
3688 | 3'UTR +21 A>G | N/A | HBB:c.*21A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72039 |
2177 | 3'UTR +32 A>C (3'UTR +1506 (A>C), Terminal CD +32 A>C) | N/A | HBB:c.*32A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72050 |
268 | 3'UTR +47 C>G (Terminal CD +47 C>G) | N/A | HBB:c.*47C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72065 |
3180 | 3'UTR +62 A>G | N/A | HBB:c.*62A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72080 |
269 | 3'UTR -13 bp [CAP +1567 to +1579] | N/A | HBB:c.*93_*105delATCTGGATTCTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72111 |
3048 | 3'UTR, +C, -TGGATTCT | N/A | HBB:c.*96_*103delTGGATTCTinsC | β | Causative | β-thalassaemia | NG_000007.3 | 72113 |
3443 | Cap +1570 (T>C) | N/A | HBB:c.*96T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72114 |
4076 | Cap +1570 (T>G) | N/A | HBB:c.*96T>G | β | Causative | β-thalassaemia | NG_000007.3 | 72114 |
270 | Poly A (A>C) AATAAA>CATAAA | N/A | HBB:c.*108A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
271 | Poly A (A>G) AATAAA>GATAAA | N/A | HBB:c.*108A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
272 | Poly A (T>C) AATAAA>AACAAA | N/A | HBB:c.*110T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
273 | Poly A (T>A) AATAAA>AAAAAA | N/A | HBB:c.*110T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
277 | Poly A (-TA); (AATAAA>AAAA) | N/A | HBB:c.*110_*111delTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
278 | Poly A (-AATAA) (polyA (-TAAAA)) | N/A | HBB:c.*110_*114del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
4025 | Poly A (-T) AATAAA>AA-AAA | N/A | HBB:c.*110del | β | Causative | β-thalassaemia, Ineffective erythropoiesis, Haemolytic anaemia | NG_000007.3 | 72128 |
274 | Poly A (A>G) AATAAA>AATGAA | N/A | HBB:c.*111A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72129 |
275 | Poly A (A>G) AATAAA>AATAGA | N/A | HBB:c.*112A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
2198 | Poly A (A>T) AATAAA>AATATA | N/A | HBB:c.*112A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
276 | Poly A (A>G) AATAAA>AATAAG | N/A | HBB:c.*113A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72131 |
3046 | 3'UTR +115-+116 (-AA) (Poly A (-AA)) | N/A | HBB:c.*115_*116del | β | Causative | β-thalassaemia | NG_000007.3 | 72133 |
3933 | 3'UTR +116 (+A) (β nt + 1590 (+A)) | N/A | HBB:c.*116dup | β | Causative | β-thalassaemia | NG_000007.3 | 72134 |
2564 | 3'UTR +118 (A>G) (3'UTR +1592 (A>G)) | N/A | HBB:c.*118A>G | β | Causative | β-thalassaemia | NG_000007.3 | 72136 |
3786 | 3'UTR +129 T>A | N/A | HBB:c.*129T>A | β | Causative | β-thalassaemia | NG_000007.3 | 72147 |
3605 | 3'UTR +132 C>T | N/A | HBB:c.*132C>T | β | Causative | β-thalassaemia | NG_000007.3 | 72150 |
4018 | 3'UTR +132 C>G | N/A | HBB:c.*132C>G | β | Causative | β-thalassaemia | NG_000007.3 | 72150 |
3932 | TTS +8 T>C (β nt +1616 T>C) | N/A | HBB:c.*142T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72160 |
3931 | TTS +22 G>C (β nt +1630 G>C) | N/A | HBB:c.*156G>C | β | Causative | β-thalassaemia | NG_000007.3 | 72174 |
3930 | TTS +43 (+A) (β nt +1651 (+A)) | N/A | HBB:c.*177dup | β | Causative | β-thalassaemia | NG_000007.3 | 72195 |
2496 | TTS +48 G>A (CAP +1656 G>A) | N/A | HBB:c.*182G>A | β | Causative | β-thalassaemia | NG_000007.3 | 72200 |
2463 | TTS +99 C>C | N/A | HBB:c.*233G>C | β | Causative | β-thalassaemia | NG_000007.3 | 72251 |
3929 | TTS +113 T>C (β nt + 1721 T>C) | N/A | HBB:c.*247T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72265 |
3689 | TTS +127 T>C | N/A | HBB:c.*261T>C | β | Causative | β-thalassaemia | NG_000007.3 | 72279 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-10-23 15:23:06