
IthaID: 2475
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | 21.9 kb deletion with 29 bp insertion | HGVS Name: | NG_000006.1:g.[14373_36299del21927; insGGGAAGGGTGGGTGGGAATAACAGCTTTT] |
Hb Name: | N/A | Protein Info: | deletion of 21927 nts from the ζ2 gene to α2 gene AND nts GGGAAGGGTGGGTGGGAATAACAGCTTTT inserted between nts 655 and 656 of ζ2 |
Also known as: | Qinzhou type deletion |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 14373 |
Size: | 21.927 kb |
Deletion involves: | ζ, α2 |
Other details
Type of Mutation: | Deletion |
---|---|
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Breakpoint Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Long J, Yan S, Lao K, Pang W, Ye X, Sun L, The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia., Blood Cells Mol. Dis. , 52(4), 225-9, 2014
- Long J, Pang W, Sun L, Lao K, Weng X, Ye X, Wu S, Song C, Wei X, Yan S, Diagnosis of a Family with the Novel -α(21.9) Thalassemia Deletion., Hemoglobin , 39(6), 419-22, 2015
Created on 2014-06-03 17:23:29,
Last reviewed on 2016-08-26 10:59:35 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.