IthaID: 2475


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: 21.9 kb deletion with 29 bp insertion HGVS Name: NG_000006.1:g.[14373_36299del21927; insGGGAAGGGTGGGTGGGAATAACAGCTTTT]
Hb Name: N/A Protein Info: deletion of 21927 nts from the ζ2 gene to α2 gene AND nts GGGAAGGGTGGGTGGGAATAACAGCTTTT inserted between nts 655 and 656 of ζ2

Also known as: Qinzhou type deletion

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 14373
Size: 21.927 kb
Deletion involves: ζ, α2

Other details

Type of Mutation: Deletion
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Breakpoint Determined: Yes

Publications / Origin

  1. Long J, Yan S, Lao K, Pang W, Ye X, Sun L, The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia., Blood Cells Mol. Dis. , 52(4), 225-9, 2014
  2. Long J, Pang W, Sun L, Lao K, Weng X, Ye X, Wu S, Song C, Wei X, Yan S, Diagnosis of a Family with the Novel -α(21.9) Thalassemia Deletion., Hemoglobin , 39(6), 419-22, 2015
Created on 2014-06-03 17:23:29, Last reviewed on 2016-08-26 10:59:35 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.