
IthaID: 2517
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 328 CGC>-GC | HGVS Name: | NG_013087.1:g.7212delC |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATTCGCGCGCTCGGACGAGCTGACC [C/-] GCCACTACCGGAAACACACGGGGCA (Strand: -)
Comments: Protein change: R328Afs. Found in individuals with borderline HbA2.
External Links
No available links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Anaemia [HP:0001903] |
Location
Chromosome: | 19 |
---|---|
Locus: | NG_013087.1 |
Locus Location: | 7212 |
Size: | 1 bp |
Located at: | KLF1 |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Lou JW, Li DZ, Zhang Y, He Y, Sun MN, Ye WL, Liu YH, Delineation of the molecular basis of borderline hemoglobin A2 in Chinese individuals., Blood Cells Mol. Dis. , 2014
Created on 2014-06-06 08:34:20,
Last reviewed on 2016-09-14 10:23:49 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.