Loading... Please wait!
Quick filtering
Showing all Point-Mutations (Show All):
IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
---|---|---|---|---|---|---|---|---|
3051 | Init CD ACCATG>-CCATG | N/A | HBA2:c.-3delA | α2 | Causative | α-thalassaemia | NG_000006.1 | 33773 |
344 | Init CD ATG>-TG | N/A | HBA2:c.1delA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33776 |
343 | Init CD ATG>A-G | N/A | HBA2:c.2delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
4071 | CD 1 (-G) | N/A | HBA2:c.4del | α2 | Causative | α-thalassaemia | NG_000006.1 | 33779 |
2206 | CD 8 (-C) | N/A | HBA2:c.27delC | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33802 |
2433 | CD 13-14 -GCCTGG [-Ala-Trp] | Hb Souli | HBA2:c.40_45delGCCTGG | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33815 |
3885 | CD 17 (-C) (Hb Kunming) | N/A | HBA2:c.54delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 33829 |
350 | CD 18 GGC>G-C | N/A | HBA2:c.56delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33831 |
353 | CD 22 -C | N/A | HBA2:c.69delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33844 |
2438 | CD 22-26 (-9 bp) | Hb Zhanjiang | HBA2:c.69_77delCGAGTATGG | α2 | Causative | α-chain variant | NG_000006.1 | 33844 |
3568 | CD 28 GCC>-CC | N/A | HBA2:c.85delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 33860 |
357 | CD 30 -GAG [-Glu] | N/A | HBA2:c.91_93delGAG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33866 |
359 | IVS I-1 (-5 bp) GAGGTGAGG>GAGG----- donor (α-5nt) | N/A | HBA2:c.95+2_95+6delTGAGG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33872 |
3729 | IVS I-11 (-24bp) (Hb Qujing) | N/A | HBA2:c.95+11_95+34del | α2 | Causative | α-thalassaemia | NG_000006.1 | 33881 |
2211 | CD 37 CCC>CC- | N/A | HBA2:c.114delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34006 |
3765 | CD 39 (-ACC) [-Thr] | Hb Taybe | HBA2:c.118_120del | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34010 |
2493 | CD 40 AAG>AA- | N/A | HBA2:c.123delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34015 |
2214 | CD 43 TTC>T-C | N/A | HBA2:c.131delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34023 |
2215 | CD 43/44 -C | N/A | HBA2:c.132delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34024 |
3405 | CD 47-53 (-20bp): (-GACCTGAGCCACGGCTCTGC) | N/A | HBA2:c.142_161del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34034 |
2216 | CD 47 -A | N/A | HBA2:c.143delA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34035 |
3053 | CD 47/48 (-4bp): (-ACCT) | N/A | HBA2:c.143_146delACCT | α2 | Causative | α-thalassaemia | NG_000006.1 | 34035 |
2535 | CD 48-54 -18 bp | Hb Fenton | HBA2:c.146_163delTGAGCCACGGCTCTGCCC | α2 | Causative | α-chain variant | NG_000006.1 | 34038 |
374 | CD 49 -GC | N/A | HBA2:c.149_150delGC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34041 |
2955 | CD 49-57 (-24bp): (-GCCACGGCTCTGCCCAGGTTAAGG) | Hb Goya | HBA2:c.149_172del | α2 | Causative | α-chain variant | NG_000006.1 | 34041 |
3039 | CD 52-59 (-24bp): (-TCTGCCCAGGTTAAGGGCCACGGC) | Hb J-Biskra | HBA2: c.157_180del | α2 | Causative | α-chain variant | NG_000006.1 | 34049 |
3693 | CD 54 CAG>-AG | N/A | HBA2:c.163delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34055 |
3054 | CD 56 AAG>--G | N/A | HBA2:c.169_170delAA | α2 | Causative | α-thalassaemia | NG_000006.1 | 34061 |
2218 | CD 63-76 (-42 bp) | N/A | HBA2:c.190_231del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34082 |
2576 | CD 68 AAC>A-C | N/A | HBA2:c.206delA | α2 | Causative | α-thalassaemia | NG_000006.1 | 34098 |
4070 | CD 68 (-C) | N/A | HBA2:c.207del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34099 |
3055 | CD 73/74 (-4bp): (-GTGG) | N/A | HBA2:c.220_223delGTGG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34112 |
611 | CD 75 (-GAC) | Hb Watts | HBA2:c.226_228del | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34118 |
3974 | CD 82-83 (-CCTG) | N/A | HBA2:c.249_252del | α2 | Causative | α-thalassaemia | NG_000006.1 | 34141 |
3569 | CD 89-93 (-13bp): (-CACAAGCTTCGGG) | N/A | HBA2:c.268_280delCACAAGCTTCGGG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34160 |
3572 | CD 90‐92 (-8bp): (‐AGCTTCGG) | N/A | HBA2:c.272_279delAGCTTCGG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34164 |
2436 | CD 107 GTG>G-G | Hb Lynwood | HBA2:c.323delT | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34357 |
398 | CD 109 (-C) | Hb Sciacca | HBA1:c.328delC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34362 |
4068 | CD 112 CAC>-AC | N/A | HBA2:c.337delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34371 |
402 | CD 112/113 -C | N/A | HBA2:c.339delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34373 |
3140 | CD 114 CCC>CC- | N/A | HBA2:c.345delC | α2 | Causative | α-thalassaemia | NG_000006.1 | 34379 |
2369 | CD 115 -GCC [-Ala] | Hb Towson | HBA2:c.346_348delGCC | α2 | Causative | α-chain variant | NG_000006.1 | 34380 |
2221 | CD 115 -GAGTTCACCCC [166 aa] | N/A | HBA2:c.349_359delGAGTTCACCCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34383 |
3305 | CD 126 GCG>-CG | N/A | HBA2:c.379delG | α2 | Causative | α-thalassaemia | NG_000006.1 | 34413 |
2480 | CD 129 CTG>-TG | Hb Hamilton Hill | HBA2:c.388delC | α2 | Causative | α-chain variant | NG_000006.1 | 34422 |
3404 | CD 133-135 (-AGCACCG) | Hb Aalesund | HBA2:c.400_406del | α2 | Causative | α-chain variant | NG_000006.1 | 34434 |
428 | 3'UTR -16 bp | N/A | HBA2:c.*74_*89delCCTTCCTGGTCTTTGA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34537 |
3250 | Init CD ATG>A-G | N/A | HBA1:c.2delT | α1 | Causative | α-thalassaemia | NG_000006.1 | 37581 |
4006 | CD 7 AAG>A-G (g.188 (GenBank MK600512.1)) | N/A | HBA1:c.23delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37602 |
370 | CD 37 -CCC [-Pro) | Hb Heraklion | HBA1:c.112_114delCCC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37808 |
4077 | CD 37 CCC>CC- | N/A | HBA1:c.114del | α1 | Causative | α-thalassaemia | NG_000006.1 | 37810 |
371 | CD 39 (-ACC) [-Thr] | Hb Taybe | HBA1:c.118_120del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37814 |
3856 | CD 40-41 (-AAGACC) | N/A | HBA1:c.121_126delAAGACC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37817 |
556 | CD 52-59 (-24 bp) | Hb J-Biskra | HBA1:c.157_180del | α1 | Causative | α-chain variant | NG_000006.1 | 37853 |
380 | CD 61 (-AAG) | Hb Clinic | HBA1:c.184_186del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37880 |
3717 | CD 61 AAG>-AG | N/A | HBA1:c.184del | α1 | Causative | α-thalassaemia | NG_000006.1 | 37880 |
381 | CD 62 (-GTG) [-Val] | Hb Aghia Sophia | HBA1:c.187_189del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37883 |
382 | CD 62 GTG>-TG | Hb Champaign | HBA1:c.187delG | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37883 |
2347 | CD 62 -G | N/A | HBA1:c.189delG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37885 |
383 | CD 64-74 (-33 bp) | N/A | HBA1:c.193_225del33 | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37889 |
3373 | CD 67 ACC>-CC | N/A | HBA1:c.202delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37898 |
385 | CD 74/75 -GAC [- Asp] | N/A | HBA1:c.212_214delGAC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37908 |
4008 | CD 72 CAC>CA- (g.502 (GenBank: MK600512.1)) | N/A | HBA1:c.219delC | α1 | Causative | α-thalassaemia | NG_000006.1 | 37915 |
3326 | CD 73 GTG>G-G | N/A | HBA1:c.221delT | α1 | Causative | α-thalassaemia | NG_000006.1 | 37917 |
386 | CD 78 -C | N/A | HBA1:c.237delC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37933 |
2219 | CD 81 -T | N/A | HBA2:c.244delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37940 |
3861 | CD 87 (-A) | N/A | HBA1:c.263delA | α1 | Causative | α-thalassaemia | NG_000006.1 | 37959 |
4093 | CD 95 (-C) | Hb Campania | HBA1:c.287delC | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37983 |
4042 | IVS II-2 (-8 bp, +1 bp) | N/A | HBA1:c.301-31_301-24delinsG | α1 | Causative | α-thalassaemia | NG_000006.1 | 38115 |
2224 | CD 110-114 (-13 bp) | N/A | HBA1:c.333_345delCGCCCACCTCCCC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38178 |
4084 | CD 133-135 (-7 bp, -GCACCGT) | N/A | HBA1:c.401_407del | α1 | Causative | α-thalassaemia | NG_000006.1 | 38246 |
760 | CD 134 -C | Hb Senlis | HBA1:c.404delC | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 38249 |
3483 | CD 121 GAA>-AA | Hb Mahasarakham | HBB:c.364delG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 6394 |
3272 | -533 (-ATAAG) | N/A | HBG2:c.-533_-529delATAAG | Gγ | Causative | HPFH, Hb F levels | NG_000007.3 | 42302 |
1467 | CD 23 (-GCT) | Hb F-Mauritius | HBG1:c.70_72del | Aγ | Causative | γ-chain variant | NG_000007.3 | 47881 |
3231 | CD 7 (-3bp): (-GAG) | N/A | HBD:c.22_24delGAG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63204 |
3232 | CD 10 GCT>-CT | N/A | HBD:c.31delG | δ | Causative | δ-thalassaemia | NG_000007.3 | 63213 |
3233 | IVS I 3' AG>-C | N/A | HBD:c.93-2delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63401 |
3806 | CD 44-48 (-CTTTGGGGATC) (p.Phe46Valfs*4) | N/A | HBD:c.135_145del | δ | Causative | δ-thalassaemia | NG_000007.3 | 63445 |
3441 | CD 59 AAG>A-G (δ0 59 (-A)) | N/A | HBD:c.179delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63489 |
3236 | CD 87 CAG>C-G | N/A | HBD:c.263delA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63573 |
3598 | CD 93/94 (-TG) [Cys>STOP] | N/A | HBD:c.282_283delTG | δ | Causative | N/A | NG_000007.3 | 63592 |
3975 | CD 98 (-GTG, +A) | N/A | HBD:c.295_297delGTGinsA | δ | Causative | δ-thalassaemia | NG_000007.3 | 63605 |
2482 | CD 137 -GTG [-Val] (Hb Anti-Lepore Lincoln Park) | Hb Lincoln Park | HBD:c.412_414delGTG | δ | Causative | δ-chain variant, Haemolytic anaemia | NG_000007.3 | 64620 |
3752 | -99 to -85 (-15bp) | N/A | HBB:c.-149_-135delGTGGAGCCACACCCT | β | Causative | β-thalassaemia | NG_000007.3 | 70446 |
3990 | -89 to -88 (-AC) | N/A | HBB:c.-139_-138delAC | β | Causative | β-thalassaemia | NG_000007.3 | 70456 |
3925 | -42 (-C) | N/A | HBB:c.-92delC | β | Causative | β-thalassaemia | NG_000007.3 | 70503 |
3062 | -30 (-T) | N/A | HBB:c.-80delT | β | Causative | β-thalassaemia | NG_000007.3 | 70515 |
24 | -29 to -26 (-AA) | N/A | HBB:c.-79_78delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
31 | -27 (-AA) | N/A | HBB:c.-77_-76delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
36 | CAP +10 (-T) (5'UTR +10 (-T)) | N/A | HBB:c.-41delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70554 |
3627 | CAP +20 (-C) | N/A | HBB:c.-31delC | β | Causative | β-thalassaemia | NG_000007.3 | 70564 |
40 | CAP +41 to +44 (-AACA) (CAP +40 to +43 (-AAAC)) | N/A | HBB:c.-10_-7delAACA | β | Causative | β-thalassaemia | NG_000007.3 | 70585 |
50 | CD 1 (-G) | N/A | HBB:c.4delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70598 |
51 | CD 2-4 (-9 bp, +31 bp) | N/A | HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3437 | CD 2 CAT>-AT | Hb Bundelkhand | HBB:c.7delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
3014 | CD 2 CAT>C-T | N/A | HBB:c.8delA | β | Causative | β-thalassaemia | NG_000007.3 | 70602 |
53 | CD 2/3 (+T); CD 5 (-C) | Hb Antalya | HBB:c.[9dupT; 17delC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603, 70611 |
3561 | CD 2 CAT/CA- | N/A | HBB:c.9delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603 |
3817 | CD 4 (-T) | N/A | HBB:c.14delC | β | Causative | β-thalassaemia | NG_000007.3 | 70608 |
54 | CD 5 -CT | N/A | HBB:c.17_18delCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70611 |
2180 | CD 5/6 -TG | N/A | HBB:c.18_19delTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70612 |
2184 | CD 6-14 (-26 bp) (26 bp deletion) | N/A | HBB:c.20_45del26bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
57 | CD 6 -A | N/A | HBB:c.20delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
58 | CD 6 (-G) | N/A | HBB:c.20delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
59 | CD 6-10 (-13 bp) | N/A | HBB:c.21_33delGGAGAAGTCTGCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70615 |
828 | CD 7 (-GAG) [-Glu] (Hb Xinyi) | Hb Leiden | HBB:c.22_24delGAG | β | Causative | β-chain variant | NG_000007.3 | 70616 |
3288 | CD7 GAG>G-G | N/A | HBB:c.23delA | β | Causative | β-thalassaemia | NG_000007.3 | 70617 |
61 | CD 8 (-AA) | N/A | HBB:c.25_26delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70619 |
3399 | CD 9 TCT>TC- | Hb Antep | HBB:c.30delT | β | Causative | β-chain variant | NG_000007.3 | 70624 |
66 | CD 10 (-C) | N/A | HBB:c.33delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
3297 | CD 11-13 (-9bp): (-GTTACTGCC) | Hb JC-Paz | HBB:c.34_42delGTTACTGCC | β | Causative | β-chain variant | NG_000007.3 | 70628 |
67 | CD 11 (-T) | N/A | HBB:c.36delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70630 |
3721 | CD 14 CTG>-TG | N/A | HBB:c.43delC | β | Causative | β-thalassaemia | NG_000007.3 | 70637 |
2553 | CD 14 CTG>C-G | N/A | HBB:c.44delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
70 | CD 15 (-T) | N/A | HBB:c.46delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70640 |
74 | CD 15/16 (-G) | N/A | HBB:c.50delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
75 | CD 16 GGC>GG- | N/A | HBB:c.51delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
855 | CD 17-19 (-GGTGAA) | Hb Lyon | HBB:c.54_59del | β | Causative | β-chain variant | NG_000007.3 | 70648 |
3609 | CD 20/21 (-TGGA) | N/A | HBB:c.62_65delTGGA | β | Causative | β-thalassaemia | NG_000007.3 | 70656 |
80 | CD 20-22 (GTGGATGAA>GTGAA) | N/A | HBB:c.64_67del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
84 | CD 22-24 ( -7 bp): (-AAGTTGG) | N/A | HBB:c.68_74delAAGTTGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70662 |
878 | CD 23/24 (GTTGGT>GGT) | Hb Freiburg | HBB:c.71_73del | β | Causative | β-chain variant | NG_000007.3 | 70665 |
85 | CD 24 (-G, +CAC) | N/A | HBB:c.74delinsCAC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
3306 | CD 25/26 -GTG [-Gly] (Hb Higashitochigi, Hb HT) | Hb M Dothan | HBB:c.77_79delGTG | β | Causative | β-chain variant | NG_000007.3 | 70671 |
93 | CD 28 (-C) | N/A | HBB:c.85delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
95 | CD 28/29 (-G) | N/A | HBB:c.89delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70683 |
3484 | CD 30 (-A) or IVS I (-2) AGG>-GG | N/A | HBB:c.91delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
280 | IVS I [3' end] (-25 bp) (25 bp deletion) | N/A | NC_000011.10(NM_000518.4):c.93-22_95del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
2173 | IVS I-109 (-T) | N/A | HBB:c.93-22delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
121 | IVS I [3' end] (-17 bp) (17 bp deletion) | N/A | HBB:c.93-17_93-1delTATTTTCCCACCCTTAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70800 |
126 | CD 31 (-C) | N/A | HBB:c.94delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70818 |
131 | CD 33-35 (-TGGTCT) | Hb Dresden | HBB:c.101_106delTGGTCT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70825 |
129 | CD 33/34 (GTGGTC>GTC) | Hb Korea | HBB:c.102_104del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
130 | CD 33-34 (-G) | N/A | HBB:c.102_103delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
3692 | CD 35 (TAC>TA-) | N/A | HBB:c.108delC | β | Causative | β-thalassaemia | NG_000007.3 | 70832 |
128 | CD 36 CCT>C-T (CD 36 (-C)) | N/A | HBB:c.110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70834 |
135 | CD 36-39 (-8 bp) | N/A | HBB:c.111_118delTTGGACCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70835 |
134 | CD 36/37 (-T) | N/A | HBB:c.112delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70836 |
136 | CD 37 (-G) | N/A | HBB:c.114delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
139 | CD 37-39 (-7 bp): (-GACCCAG) | N/A | HBB:c.114_120del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
141 | CD 38/39 (-CC) | N/A | HBB:c.117_118delCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70841 |
140 | CD 38/39 (-C) | N/A | HBB:c.118delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
2393 | CD 39 -A | N/A | HBB:c.119delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70843 |
143 | CD 40 (-G) | N/A | HBB:c.123delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
146 | CD 41 (-C) | N/A | HBB:c.126delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
147 | CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT)) | N/A | HBB:c.126_129delCTTT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
945 | CD 42 (-TTT) | Hb Bruxelles | HBB:c.127_129delTTT | β | Causative | β-chain variant | NG_000007.3 | 70851 |
2954 | CD 42 TTT>TT- | Hb Yala | HBB:c.129delT | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70853 |
946 | CD 43-46 (-9bp) | Hb Niteroi | HBB:c.131_139del | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70855 |
151 | CD 44 -C | N/A | HBB:c.135delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70859 |
152 | CD 45 (-T) | N/A | HBB:c.138delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
2187 | CD 48 -T | N/A | HBB:c.146delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70870 |
2407 | CD 49-55 (-19 bp +4 bp) | Hb Martinez | HBB:c.149_167delinsAGCT | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 70873 |
157 | CD 49 (-C) | N/A | HBB:c.150delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70874 |
158 | CD 50 (-T) | N/A | HBB:c.153delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70877 |
159 | CD 51 (-C) | N/A | HBB:c.155delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70879 |
2959 | CD 52 GAT>G-T | N/A | HBB:c.158delA | β | Causative | β-thalassaemia | NG_000007.3 | 70882 |
160 | CD 53 (-T) | N/A | HBB:c.162delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70886 |
4094 | CD 54 GTT>-TT | N/A | HBB:c.163del | β | Causative | β-thalassaemia | NG_000007.3 | 70887 |
162 | CD 54 -T | N/A | HBB:c.165delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
165 | CD 55 (-A) | N/A | HBB:c.166delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
2990 | CD 55-59 (-13 bp) | N/A | HBB:c.167_179del | β | Causative | β-thalassaemia | NG_000007.3 | 70891 |
989 | CD 56-60 (-12bp) | Hb Tochigi | HBB:c.170_181del | β | Causative | β-chain variant | NG_000007.3 | 70894 |
3311 | CD 58 CCT>C-T | N/A | HBB:c.176delC | β | Causative | β-thalassaemia | NG_000007.3 | 70900 |
168 | CD 59 -A | N/A | HBB:c.179delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70903 |
4086 | CD 59 AAG>AA-, CD 59 (-G) | N/A | HBB:c.180del | β | Causative | β-thalassaemia | NG_000007.3 | 70904 |
3855 | CD 60 GTG>-TG [Val>STOP] | N/A | HBB:c.181delG | β | Causative | β-thalassaemia | NG_000007.3 | 70905 |
3298 | CD 60-61 (-6bp): (-TGAAGG) | Hb Tavapy | HBB:c.182_187delTGAAGG | β | Causative | β-chain variant | NG_000007.3 | 70906 |
3589 | CD 62-65 (-12bp) | N/A | HBB:c.187_198delGCTCATGGCAAG | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 70911 |
171 | CD 62-64 (-7bp) | N/A | HBB:c.189_195delTCATGGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70913 |
173 | CD 64 (-G) | N/A | HBB:c.194delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70918 |
3854 | CD 66/67 (-AAAG) | N/A | HBB:c.199_202delAAAG | β | Causative | β-thalassaemia | NG_000007.3 | 70923 |
2188 | CD 66 -A | N/A | HBB:c.201delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70925 |
175 | CD 67 (-TG) | N/A | HBB:c.203_204delGT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70927 |
3019 | CD 68-70 (-7bp): (-TCGGTGC) | N/A | HBB:c.206_212delTCGGTGC | β | Causative | β-thalassaemia | NG_000007.3 | 70930 |
2522 | CD 69 GGT>G-T | N/A | HBB:c.209delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70933 |
2189 | CD 69 -T | N/A | HBB:c.210delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70934 |
2462 | CD 71 -T | N/A | HBB:c.216delT | β | Causative | β-thalassaemia | NG_000007.3 | 70940 |
178 | CD 72-73 (-AGTGA, +T) | N/A | HBB: c.217_221delAGTGAinsT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
1044 | CD 74-76 (-GCCTGG) | Hb Saint-Antoine | HBB:c.224_229delGCCTGG | β | Causative | β-chain variant | NG_000007.3 | 70948 |
179 | CD 75 (-C) | N/A | HBB:c.226delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70950 |
1049 | CD 75 (-CTG) | Hb Vicksburg | HBB:c.226_228delCTG | β | Causative | β-chain variant | NG_000007.3 | 70950 |
1050 | CD 75 CTG>CCG; CD 141 (-CTG) | Hb Atlanta-Coventry | HBB:c.[227T>C;424_426delCTG] | β | Causative | β-chain variant | NG_000007.3 | 70951 |
180 | CD 76 GCT>--T (-GC) | N/A | HBB:c.229_230delGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70953 |
181 | CD 76 (-C) | N/A | HBB:c.230delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70954 |
182 | CD 78 CTG>-TG | N/A | HBB:c.235delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70959 |
3225 | CD 78/85 (-20bp) | N/A | HBB:c.237_256delGGACAACCTCAAGGGCACCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70961 |
2445 | CD 80 -AAC [-Asn] | Hb Saint-Chamond | HBB:c.241_243delAAC | β | Causative | β-chain variant | NG_000007.3 | 70965 |
183 | CD 80/81 (-C) | N/A | HBB:c.244delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
184 | CD 81-87 (-22 bp) | N/A | HBB:c.244_265del22 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
185 | CD 82/83 (-G) | N/A | HBB:c.251delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70975 |
186 | CD 84-86 (-8 bp): (-CACCTTTG) | N/A | HBB:c.253_260del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70977 |
3965 | CD 84-87 (-CTTTGCCACA) (+TTTTTCTCAG) (Hb Donguan-Dongcheng) | Hb Wanjiang | HBB:c.255_264delinsTTTTTCTCAG | β | Causative | β-chain variant | NG_000007.3 | 70979 |
3722 | CD 86 GCC>GC- | N/A | HBB:c.261delC | β | Causative | β-thalassaemia | NG_000007.3 | 70985 |
1087 | CD 87 (-ACA) | Hb Tours | HBB:c.262_264delACA | β | Causative | β-chain variant | NG_000007.3 | 70986 |
4044 | CD 87-91 (-14 bp) | N/A | HBB:c.263_276del | β | Causative | β-thalassaemia | NG_000007.3 | 70987 |
3253 | CD 88 CTG>--G (HBB:c.265_266delCT) | N/A | HBB:c.265_266del | β | Causative | β-thalassaemia | NG_000007.3 | 70989 |
190 | CD 88 (-TG) | N/A | HBB:c.266_267del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
3287 | CD 89-93 (-14bp): (-AGTGAGCTGCACTG) | N/A | HBB:c.268_281delAGTGAGCTGCACTG | β | Causative | β-thalassaemia | NG_000007.3 | 70992 |
191 | CD 89/90 (AGTGAG>AGAG) | N/A | HBB:c.270_271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70994 |
2965 | CD 89-90 (-TGAG) | Hb Wilde | HBB:c.270_273delTGAG | β | Causative | β-chain variant | NG_000007.3 | 70994 |
3044 | CD 90 GAG>-AG | N/A | HBB:c.271delG | β | Causative | β-thalassaemia | NG_000007.3 | 70995 |
193 | CD 91 CTG>C-G | Hb Morgantown | HBB:c.275del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
1100 | CD 93-97 (-15 bp) | Hb Gun Hill | Hb GH | HBB:c.280_294delTGTGACAAGCTGCAC | β | Causative | β-chain variant | NG_000007.3 | 71004 |
1125 | CD 97/98 (-ACG) | Hb Galicia | HBB:c.293_295delACG | β | Causative | β-chain variant | NG_000007.3 | 71017 |
3636 | CD 104 (-A) | N/A | HBB:c.313delA | β | Causative | β-thalassaemia | NG_000007.3 | 71037 |
199 | IVS II-1 (-G) | N/A | HBB:c.315+1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
205 | IVS II-2 (-T) | N/A | HBB:c.315+2del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
206 | IVS II-2/3 (-2 bp, +11 bp) (IVS II-2,3 (+11/-2)) | N/A | HBB:c.315+2_315+3delinsACGTTCTCTGA | β | Causative | β-thalassaemia | NG_000007.3 | 71041 |
2182 | IVS II-2 -TGAGTCTATGGG | N/A | HBB:c.315+2_315+13delTGAGTCTATGGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
207 | IVS II 4/5 -AG | N/A | NG_000007.3:g.71043_71044delAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71043 |
3247 | IVS II-209 (-TTTT) | N/A | HBB:c.315+209_315+212delTTTT | β | Neutral | N/A | NG_000007.3 | 71248 |
3683 | IVS II-308 (-A) | N/A | HBB:c.315+308delA | β | Causative | β-thalassaemia | NG_000007.3 | 71347 |
3797 | IVS II-509 (-A) | N/A | HBB:c.316-342delA | β | Causative | β-thalassaemia | NG_000007.3 | 71548 |
3391 | IVS II-648/649 (-T) | N/A | HBB:c.316-202del | β | Causative | β-thalassaemia | NG_000007.3 | 71688 |
3866 | IVS II-659_664 (-GCAATA) | N/A | HBB:c.316-192_187del | β | Causative | β-thalassaemia | NG_000007.3 | 71698 |
3616 | IVS II-809 (-G) | N/A | HBB:c.316-42delG | β | Causative | β-thalassaemia | NG_000007.3 | 71848 |
3045 | IVS II-848 C>T | N/A | HBB: c.316-3C>T | β | Causative | β-thalassaemia | NG_000007.3 | 71887 |
228 | IVS II-850 (-G) | N/A | HBB:c.316-1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
2191 | CD 107-111 (-12 bp): (-GCAACGTGCTGG) | N/A | HBB:c.323_334del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
232 | CD 108-112 (-12 bp) Asn-Val-Leu-Val-Cys to Ser | N/A | HBB:c.326_337delACGTGCTGGTCT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71900 |
233 | CD 109 (-G) >156aa | Hb Manhattan | HBB:c.328delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71902 |
3024 | CD 111-115 (-12bp): (-TCTGTGTGCTGG) | N/A | HBB:c.335_346del | β | Causative | β-thalassaemia | NG_000007.3 | 71909 |
236 | CD 113 (-G) >156aa | N/A | HBB:c.340delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71914 |
238 | CD 114 (-CT, +G) >156aa | Hb Geneva | HBB:c.343_344delinsG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71917 |
3308 | CD 115-116 (-CC, +G) >156aa | Hb Grand Junction | HBB:c.348_349delinsG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 71922 |
3228 | CD 116 CAT>-AT | N/A | HBB:c.349del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71923 |
2193 | CD 117 -C | N/A | HBB:c.354delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71928 |
3846 | CD 118 (-TT) | N/A | HBB:c.356_357delTT | β | Causative | β-thalassaemia | NG_000007.3 | 71930 |
241 | CD 118 (-T) > 156aa | Hb Sainte Seve | HBB:c.357delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71931 |
242 | CD 120 -A [156 aa] (CD 120 AAA>AA-) | Hb Filottrano | HBB:c.363delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
245 | CD 123 (-A) >156aa | Hb Makabe | HBB:c.370delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
246 | CD 123-125 (-ACCCCACC) >135aa | Hb Khon Kaen | HBB:c.370_378delACCCCACCA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
4065 | CD 124 (-C) | N/A | HBB:c.374delC | β | Causative | α-thalassaemia | NG_000007.3 | 71948 |
247 | CD 124 (-A) >156aa | N/A | HBB:c.375delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
2195 | CD 125-127 (-CAGTGC) | N/A | HBB:c.377_382delCAGTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71951 |
249 | CD 125 (-A) >156aa | N/A | HBB:c.378delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71952 |
250 | CD 126 (-T) >156aa | Hb Vercelli | HBB:c.380delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71954 |
252 | CD 126-131 (-17 bp) | Hb Westdale | HBB:c.380_396delTGCAGGCTGCCTATCAG | β | Causative | β-thalassaemia, β-chain variant | NG_000007.3 | 71954 |
4087 | CD 128-134 (-21bp): (-CAGGCTGCCTATCAGAAAGTG) | N/A | HBB:c.382_402del | β | Causative | β-thalassaemia | NG_000007.3 | 71956 |
256 | CD 127/128 -AGG [Glu-Ala>Pro] | Hb Gunma | HBB:c.383_385delAGG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
257 | CD 128/129 (-4, +5, -11 bp) >153aa | N/A | HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71959 |
3927 | CD 128 GCT>-CT | N/A | HBB:c.385delG | β | Causative | β-thalassaemia | NG_000007.3 | 71959 |
3951 | CD 129-133 (-CCTATCAGAAAGT) | Hb Phoenix | HBB:c.389_401del | β | Causative | β-chain variant | NG_000007.3 | 71963 |
260 | CD 131-132 (-GA) >138aa | N/A | HBB:c.396_397delGA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
261 | CD 131-134 (-11bp) >134aa | N/A | HBB:c.396_406del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
3896 | CD 132 (AAA>AA-) | N/A | HBB:c.399del | β | Causative | β-thalassaemia | NG_000007.3 | 71973 |
263 | CD 134-137 (-12, +6 bp) Val-Ala-Gly-Val to Gly-Arg | N/A | HBB:c.404_413delinsGCAG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71978 |
3249 | CD 135 GCT>GC- | Hb Urumqi | HBB:c.408delT | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71982 |
264 | CD 137-139 (-TGGCTA) Val-Ala-Asn to Asp | Hb Stara Zagora | HBB:c.413_418delTGGCTA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71987 |
265 | CD 141 (-C) >156aa | Hb Florida | HBB:c.424delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71998 |
1287 | CD 141 (-CTG) | Hb Coventry | HBB:c.424_426delCTG | β | Causative | β-chain variant | NG_000007.3 | 71998 |
1288 | CD 141-144 (-TGGCCCACA) | Hb Birmingham | HBB:c.425_433delTGGCCCACA | β | Causative | β-chain variant | NG_000007.3 | 71999 |
1290 | CD 142 (-CC) | Hb Uzes | HBB:c.429_430delCC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72003 |
2024 | CD 143 (-C) | Hb Montreal II | HBB:c.430delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72004 |
1294 | CD 143 (-A) | Hb Saverne | HBB:c.431delA | β | Causative | β-chain variant | NG_000007.3 | 72005 |
1302 | CD 144 (-A) | Hb Trento | HBB:c.434delA | β | Causative | β-chain variant | NG_000007.3 | 72008 |
3048 | 3'UTR, +C, -TGGATTCT | N/A | HBB:c.*96_*103delTGGATTCTinsC | β | Causative | β-thalassaemia | NG_000007.3 | 72113 |
277 | Poly A (-TA); (AATAAA>AAAA) | N/A | HBB:c.*110_*111delTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
278 | Poly A (-AATAA) (polyA (-TAAAA)) | N/A | HBB:c.*110_*114del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
4025 | Poly A (-T) AATAAA>AA-AAA | N/A | HBB:c.*110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
3046 | 3'UTR +115-+116 (-AA) (Poly A (-AA)) | N/A | HBB:c.*115_*116del | β | Causative | β-thalassaemia | NG_000007.3 | 72133 |
2819 | rs45606437 | N/A | NG_011968.1:g.62525delG | BCL11A | Modifier | Hb F levels | NG_011968.1 | 62525 |
2840 | rs66650371 | N/A | NC_000006.12:g.135097495_135097497delTAC | HBS1L-MYB | Modifier | Hb F levels, Abnormal platelet count, Abnormal white blood cell count, Abnormal red blood cell count, Anaemia | NT_025741.15 | |
2076 | CD 54-57 (-11bp): (-GAAGTCTGAGG) | N/A | NG_013087.1:g.6133_6143delGAAGTCTGAGG | KLF1 | Modifier | Hb F levels | NG_013087.1 | 6133 |
3091 | CD 290/293 (-12bp) or CD 290/294 (-12bp) | N/A | NG_013087.1:g.6842_6853delTACACCAAGAGC | NG_013087.1:g.6843_6854delACACCAAGAGCT | KLF1 | Modifier | Hb F levels | NG_013087.1 | 6842, 6843 |
2087 | IVS II-252_255 (-4bp): (-CTAG) | N/A | NG_013087.1:g.7140_7143delCTAG | KLF1 | Modifier | Hb F levels | NG_013087.1 | 7140 |
3486 | CD 314 GAA>GA- (c.942delA) | N/A | NG_013087.1:g.7172delA | KLF1 | Modifier | Hb F levels | NG_013087.1 | 7172 |
2517 | CD 328 CGC>-GC | N/A | NG_013087.1:g.7212delC | KLF1 | Modifier | Anaemia | NG_013087.1 | 7212 |
3332 | rs4025935 | N/A | NG_009246.1:g.4023_4024delTG | GSTM1 | Modifier | Cardiac iron load, Anaemia | NG_009246.1 | 4023 |
3206 | rs71785313 (APOL1 G2) | N/A | NG_023228.1:g.17930_17935delTTATAA | APOL1 | Modifier | Abnormal GFR, Proteinuria, Albuminuria | NG_023228.1 | 17930 |
2784 | rs55659002 (713-8delC) | N/A | NG_013364.1:g.16889delC | TGFB1 | Modifier | Osteoporosis | NG_013364.1 | 16889 |
3085 | rs200434923 | N/A | NG_012856.2:g.45214_45218delCCCCA | TMPRSS6 | Modifier | Abnormal hepcidin level | NG_012856.2 | 45214 |
3979 | PUM1:p.H1090Pfs*16 | N/A | NC_000001.11:g.30936810_30936813del, NM_001020658.2(PUM1):c.3267_3270del | PUM1 | Modifier | Hb F levels | N/A | |
3536 | rs1479076497 | N/A | NC_000010.11:g.70151278_70151284del | SAR1A | Modifier | Response to hydroxyurea | NM_001142648.2 | |
3537 | rs1180306451 | N/A | NC_000010.11:g.70151277_70151284del | SAR1A | Modifier | Response to hydroxyurea | NM_001142648.2 | |
3540 | rs1482813291 | N/A | NC_000010.11:g.70151276_70151284del | SAR1A | Modifier | Response to hydroxyurea | NM_001142648.2 | 0 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-10-23 15:23:06