
IthaID: 2520
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 147 TGA>TTA | HGVS Name: | HBD:c.443G>T |
Hb Name: | N/A | Protein Info: | δ 147 Stop>Leu |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AATGCCCTGGCTCACAAGTACCATT [G/T] AGATCCTGGACTGTTTCCTGATAAC (Strand: -)
Comments: The mutation results in an elongation of the transcript with 15 extra amino acids before reaching the new stop codon (TAG).
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | δ-thalassaemia, δ-chain variant |
Allele Phenotype: | δ0 |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 64651 |
Size: | 1 bp |
Located at: | δ |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | Oman |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Hassan SM, Harteveld CL, Bakker E, Giordano PC, Known and New δ-Globin Gene Mutations and Other Factors Influencing Hb A2 Measurement in the Omani Population., Hemoglobin , 2014
- Alkindi S, AlZadjali S, Daar S, Ambusaidi R, Gravell D, Al Haddabi H, Krishnamoorthy R, Pathare A, First report of the spectrum of δ-globin gene mutations in Omani subjects - identification of novel mutations., Int J Lab Hematol , 2014
Created on 2014-07-15 10:10:21,
Last reviewed on 2014-08-22 09:38:40 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.