
IthaID: 2526
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 142 TAA>TTA >172aa | HGVS Name: | HBA2:c.428A>T |
| Hb Name: | Hb Kinshasa | Protein Info: | α2 142, Stop>Leu; modified C-terminal sequence: (142)Leu-Ala-Gly-Ala-Ser-Val-Ala-Val-Pro-Pro-Ala-Arg-Trp-Ala-Ser-Gln-Arg-Ala-Leu-Leu-Pro-Ser-Leu-His-Arg-Pro-Phe-Leu-Val-Phe-(172)Glu-COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACCGTGCTGACCTCCAAATACCGTT [A/T] AGCTGGAGCCTCGGTAGCCGTTCCT (Strand: +)
External Links
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Hyperunstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34462 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Congolese |
| Molecular mechanism: | Elongated globin |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Saller E, Dutly F, Frischknecht H, Two novel α2 gene mutations causing altered amino acid sequences produce a mild (Hb Kinshasa, HBA2: c.428A > T) and severe (HBA2: c.342-345insCC) α-thalassemia phenotype., Hemoglobin , 39(2), 144-6, 2015
Created on 2014-10-09 11:15:42,
Last reviewed on 2016-09-09 09:39:24 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.