Loading... Please wait!
Quick filtering
Showing all α-chain variants (Show All):
IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
---|---|---|---|---|---|---|---|---|
348 | -α3.7;CD 14 TGG>CGG | Hb Evanston | N/A | α1 or α2, α3.7 hybrid | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | |
400 | -α3.7;CD 109 CTG>CGG | Hb Suan Dok | N/A | α2, α3.7 hybrid | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | |
3027 | Init CD ATG>ATT [Met>Ile] | Hb Valdecilla | HBA2:c.3G>T | α2 | Causative | α-chain variant | NG_000006.1 | 33778 |
431 | CD 1 GTG>ATG [Val>Met] | Hb A2-Fontanabuona | HBA2:c.4G>A | α2 | Causative | α-chain variant | NG_000006.1 | 33779 |
2306 | CD 1 GTG>CTG (Val>Leu) | Hb St. Josef | HBA2:c.4G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33779 |
432 | CD 1 GTG>GGG [Val>Gly] | Hb Antananarivo | HBA1:c.5T>G | HBA2:c.5T>G | α1, α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33780, 37584 |
433 | CD 1 GTG>GAG [Val>Glu] | Hb Thionville | HBA1:c.5T>A | HBA2:c.5T>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33780, 37584 |
434 | CD 1 GTG>GCG [Val>Ala] | Hb Lyon-Bron | HBA2:c.5T>C | α2 | Causative | α-chain variant | NG_000006.1 | 33780 |
2361 | CD 2 CTG>CCG [Leu>Pro] | Hb Kaiser West End | HBA2:c.8T>C | α2 | Causative | α-chain variant | NG_000006.1 | 33783 |
436 | CD 3 TCT>CCT [Ser>Pro] | Hb Central Middlesex | HBA1:c.10T>C | HBA2:c.10T>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33785, 37589 |
2371 | CD 3 TCT>TGT [Ser>Cys] | Hb Teterboro | HBA2:c.11C>G | α2 | Causative | α-chain variant | NG_000006.1 | 33786 |
2489 | CD 3 TCT>TAT [Ser>Tyr] | Hb Tallahassee | HBA2:c.11C>A | α2 | Causative | α-chain variant | NG_000006.1 | 33786 |
438 | CD 4 CCT>CGT [Pro>Arg] | Hb Gorée | HBA2:c.14C>G | α2 | Causative | α-chain variant | NG_000006.1 | 33789 |
439 | CD 4 CCT>CAT [Pro>His] | Hb Bellevue | HBA2:c.14C>A | α2 | Causative | α-chain variant | NG_000006.1 | 33789 |
440 | CD 5 GCC>CCC [Ala>Pro] | Hb Karachi | HBA1:c.16G>C | HBA2:c.16G>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33791, 37595 |
3983 | CD 5 GCC>ACC [Ala>Thr] | Hb Hengqin II | HBA2:c.16G>A | α2 | Causative | α-chain variant | NG_000006.1 | 33791 |
443 | CD 6 GAC>AAC [Asp>Asn] | Hb Dunn | HBA1:c.19G>A | HBA2:c.19G>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33794, 37598 |
445 | CD 6 GAC>CAC [Asp>His] | Hb Galliera II | HBA2:c.19G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33794 |
446 | CD 6 -GAC [-Asp] | Hb Boyle Heights | HBA1:c.19_21delGAC | HBA2:c.19_21delGAC | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33794, 37598 |
3038 | CD 6 GAC>TAC [Asp>Tyr] | Hb Woodville | HBA2:c.19G>T | α2 | Causative | α-chain variant | NG_000006.1 | 33794 |
447 | CD 6 GAC>GGC [Asp>Gly] | Hb Swan River | HBA2:c.20A>G | α2 | Causative | α-chain variant | NG_000006.1 | 33795 |
448 | CD 6 GAC>GTC [Asp>Val] | Hb Ferndown | HBA1:c.20A>T | HBA2:c.20A>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33795, 37599 |
449 | CD 6 GAC>GCC [Asp>Ala] | Hb Sawara | HBA1:c.20A>C | HBA2:c.20A>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33795, 37599 |
2383 | CD 7 AAG>CAG [Lys>Gln] | Hb J-Brainerd | HBA2:c.22A>C | α2 | Causative | α-chain variant | NG_000006.1 | 33797 |
3762 | CD 7 AAG>GAG [Lys>Glu] | Hb Kurosaki | NM_000517.6(HBA2):c.22A>G | α2 | Causative | α-chain variant | NG_000006.1 | 33797 |
451 | CD 7 AAG>AGG [Lys>Arg] | Hb Guanajuato | HBA2:c.23A>G | α2 | Causative | α-chain variant | NG_000006.1 | 33798 |
2384 | CD 7 AAG>ACG [Lys>Thr] | Hb Nayarit | HBA2:c.23A>C | α2 | Causative | α-chain variant | NG_000006.1 | 33798 |
452 | CD 7 AAG>AAC [Lys>Asn] | Hb Tatras | HBA1:c.24G>C | HBA2:c.24G>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33799, 37603 |
2206 | CD 8 (-C) | N/A | HBA2:c.27delC | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33802 |
454 | CD 9 AAC>AGC [Asn>Ser] | Hb Zurich-Hottingen | HBA2:c.29A>G | α2 | Causative | α-chain variant | NG_000006.1 | 33804 |
455 | CD 9 AAC>ACC [Asn>Thr] | Hb Broomfield | HBA1:c.29A>C | HBA2:c.29A>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33804, 37608 |
457 | CD 9 AAC>AAG [Asn>Lys] | Hb Park Ridge | HBA2:c.30C>G | α2 | Causative | α-chain variant | NG_000006.1 | 33805 |
3402 | CD 9 AAC>AAA [Asn>Lys] | Hb Zhaoqing | HBA2:c.30C>A | α2 | Causative | α-chain variant | NG_000006.1 | 33805 |
458 | CD 11 AAG>CAG [Lys>Gln] | Hb J-Wenchang-Wuming | HBA2:c.34A>C | α2 | Causative | α-chain variant | NG_000006.1 | 33809 |
459 | CD 11 AAG>CAG [Lys>Glu] | Hb Anantharaj | HBA2:p.Lys12Glu | HBA1:p.Lys12Glu | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33809, 37613 |
3791 | CD 11 AAG>GAG [Lys>Glu] | Hb Arbresle | HBA2:c.34A>G | α2 | Causative | α-chain variant | NG_000006.1 | 33809 |
3713 | CD 11 AAG>ACG [Lys>Thr] | N/A | HBA2:c.35A>C | α2 | Causative | α-chain variant | NG_000006.1 | 33810 |
460 | CD 11 AAG>AAC or AAT [Lys>Asn] | Hb Albany-Suma | HBA1:c.36G>C | HBA1:c.36G>T | HBA2:c.36G>C | HBA2:c.36G>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33811, 37615 |
2499 | CD 12 GCC>GAC [Ala>Asp] (Hb J-Aljezur) | Hb J-Paris-I | HBA1:c.38C>A | α1 | Causative | α-chain variant | NG_000006.1 | 33813 |
462 | CD 13 GCC>CCC [Ala>Pro] | Hb Ravenscourt Park | HBA1:c.40G>C | HBA2:c.40G>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33815, 37619 |
2433 | CD 13-14 -GCCTGG [-Ala-Trp] | Hb Souli | HBA2:c.40_45delGCCTGG | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33815 |
3599 | CD 13 GCC>TCC [Ala>Ser] | Hb Binyang | HBA2:c.40G>T | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 33815 |
2977 | CD 13 GCC>GAC [Ala>Asp] | Hb Little Waltham | HBA2:c.41C>A | α2 | Causative | α-chain variant | NG_000006.1 | 33816 |
3984 | CD 13 GCC>GTC [Ala>Val] | Hb Huidong | HBA2:c.41C>T | α2 | Causative | α-chain variant | NG_000006.1 | 33816 |
2348 | CD 14 TGG>TTG [Trp>Leu] | N/A | HBA2:c.44G>T | α2 | Causative | α-chain variant | NG_000006.1 | 33819 |
464 | CD 14 TGG>TGC [Trp>Cys] | Hb Bladensburg | HBA2:c.45G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33820 |
3761 | CD 15 GGT>CGT [Gly>Arg] | Hb Ottawa | HBA2:c.46G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33821 |
3841 | CD 15 GGT>AGT [Gly>Ser] | Hb Nanchang | HBA2:c.46G>A | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 33821 |
3916 | CD 15 GGT>TGT [Gly>Cys] | Hb Orbassano | HBA2:c.46G>T | α2 | Causative | α-chain variant | NG_000006.1 | 33821 |
3487 | CD 15 GGT>GTT [Gly>Val] | Hb Liaoning | HBA2:c.47G>T | α2 | Causative | α-chain variant | NG_000006.1 | 33822 |
467 | CD 16 AAG>GAG [Lys>Glu] (Hb I-Burlington, Hb I-Philadelphia, Hb I-Skamania, Hb I-Texas) | HbI | HBA2:c.49A>G | α2 | Causative | α-chain variant | NG_000006.1 | 33824 |
3623 | CD 16 AAG>CAG [Lys>Gln] | Hb Heilongjiang | HBA2:c.49A>C | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 33824 |
469 | CD 16 AAG>ACG [Lys>Thr] | Hb Boa Esperanca | HBA2:c.50A>C | α2 | Causative | α-chain variant | NG_000006.1 | 33825 |
470 | CD 16 AAG>AAT [Lys>Asn] | Hb Beijing | HBA2:c.51G>T | α2 | Causative | α-chain variant | NG_000006.1 | 33826 |
3064 | CD 17 GTC>TTC [Val>Phe] | Hb Dapu | HBA2:c.52G>T | α2 | Causative | α-chain variant | NG_000006.1 | 33827 |
2978 | CD 17 GTC>GAC [Val>Asp] | Hb Oxford | HBA2:c.53T>A | α2 | Causative | α-chain variant | NG_000006.1 | 33828 |
3037 | CD 18 GGC>CGC [Gly>Arg] | Hb Handsworth | HBA2:c.55G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33830 |
472 | CD 18 GGC>GAC [Gly>Asp] | Hb Al-Ain Abu Dhabi | HBA1:c.56G>A | HBA2:c.56G>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33831, 37635 |
473 | CD 19 GCG>GAG [Ala>Glu] | Hb J-Tashikuergan | HBA2:c.59C>A | α2 | Causative | α-chain variant | NG_000006.1 | 33834 |
474 | CD 19 GCG>GAY [Ala>Asp] | Hb J-Kurosh | HBA2:c.59_60delinsAY^HBA1:c.59_60delinsAY | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33834, 37638 |
3715 | CD 19 GCG>GTG [Ala>Val] | N/A | HBA2:c.59C>T | α2 | Causative | α-chain variant | NG_000006.1 | 33834 |
475 | CD 20 CAC>TAC [His>Tyr] | Hb Necker Enfants-Malades | HBA1:c.61C>T | HBA2:c.61C>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33836, 37640 |
476 | CD 20 CAC>GAC [His>Asp] | Hb Nikaia | HBA2:c.61C>G | α2 | Causative | α-chain variant | NG_000006.1 | 33836 |
478 | CD 20 CAC>CGC [His>Arg] | Hb Hobart | HBA1:c.62A>G | HBA2:c.62A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33837, 37641 |
3989 | CD 20 CAC>CTC [His>Leu] | Hb Hebei | HBA2: c.62A>T | α2 | Causative | α-chain variant | NG_000006.1 | 33837 |
479 | CD 20 CAC>CAA [His>Gln] | Hb Le Lamentin | HBA2:c.63C>A | α2 | Causative | α-chain variant | NG_000006.1 | 33838 |
351 | CD 21 GCT>TCT [Ala>Ser] | Hb Zoetermeer | HBA2:c.64G>T | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33839 |
481 | CD 21 GCT>CCT [Ala>Pro] | Hb Fontainebleau | HBA2:c.64G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33839 |
2351 | CD 21 GCT>GTT [Ala>Val] | Hb Venetia | HBA2:c.65C>T | α2 | Causative | α-chain variant | NG_000006.1 | 33840 |
483 | CD 22 GGC>GAC [Gly>Asp] | Hb J-Medellin | HBA1:c.68G>A | HBA2:c.68G>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33843, 37647 |
2438 | CD 22-26 (-9 bp) | Hb Zhanjiang | HBA2:c.69_77delCGAGTATGG | α2 | Causative | α-chain variant | NG_000006.1 | 33844 |
484 | CD 23 GAG>CAG [Glu>Gln] | Hb Memphis | HBA2:c.70G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33845 |
485 | CD 23 GAG>AAG [Glu>Lys] (Hb E-Keelung) | Hb Chad | HBA2:c.70G>A | α2 | Causative | α-chain variant | NG_000006.1 | 33845 |
3915 | -α3.7;CD 23 GAG>AAG | Hb Chad | NG_000006.1:g.34247_38050del;33845G>A | α3.7 hybrid | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 33845 |
486 | CD 23 GAG>GGG [Glu>Gly] | Hb Reims | HBA1:c.71A>G | HBA2:c.71A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33846, 37650 |
487 | CD 23 GAG>GTG [Glu>Val] | Hb G-Audhali | HBA1:c.71A>T | HBA2:c.71A>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33846, 37650 |
2368 | CD 23 GAG>GCG [Glu>Ala] | Hb Dayton | HBA2:c.71A>C | α2 | Causative | α-chain variant | NG_000006.1 | 33846 |
488 | CD 23 GAG>GAT [Glu>Asp] | Hb Lisbon | HBA1:c.72G>T | HBA2:c.72G>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33847, 37651 |
489 | CD 24 TAT>CAT [Tyr>His] | Hb Luxembourg | HBA1:c.73T>C | HBA2:c.73T>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33848, 37652 |
490 | CD 24 TAT>GAT [Tyr>Asp] | Hb Creve Coeur | HBA2:c.73T>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 33848 |
3985 | CD 25 GGT>AGT [Gly>Ser] | Hb Jinwan | HBA2:c.76G>A | α2 | Causative | α-chain variant | NG_000006.1 | 33851 |
2538 | CD 25 GGT>GAT [Gly>Asp] | Hb Cibeles | HBA2:c.77G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33852 |
355 | CD 26 GCG>ACG [Ala>Thr] | Hb Caserta | HBA2:c.79G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33854 |
493 | CD 26 GCG>GTG [Ala>Val] | Hb Campinas | HBA2:c.80C>T | α2 | Causative | α-chain variant | NG_000006.1 | 33855 |
494 | CD GCG>GAG [Ala>Glu] | Hb Shenyang | HBA2:c.80C>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 33855 |
495 | CD 27 GAG>AAG [Glu>Lys] | Hb Shuangfeng | HBA2:c.82G>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 33857 |
496 | CD 27 GAG>GGG [Glu>Gly] | Hb Fort Worth | HBA2:c.83A>G | α2 | Causative | α-chain variant | NG_000006.1 | 33858 |
497 | CD 27 GAG>GTG [Glu>Val] | Hb Spanish Town | HBA2:c.83A>T | α2 | Causative | α-chain variant | NG_000006.1 | 33858 |
498 | CD 27 GAG>GCG [Glu>Ala] | Hb Hackney | HBA1:c.83A>C | HBA2:c.83A>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 33858, 37662 |
499 | CD 27 GAG>GAC [Glu>Asp] | Hb Hekinan | HBA2:c.84G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33859 |
356 | CD 29 CTG>CCG [Leu>Pro] | Hb Agrinio | HBA2:c.89T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33864 |
503 | CD 30 GAG>AAG [Glu>Lys] | Hb O-Padova | HBA2:c.91G>A | α2 | Causative | α-chain variant | NG_000006.1 | 33866 |
3766 | CD 30 GAG>CAG [Glu>Gln] | Hb G-Honolulu | HBA2:c.91G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33866 |
2487 | CD 31 AGG>GGG [Arg>Gly] | Hb Maranon | HBA2:c.94A>G | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 33869 |
3217 | CD 31 AGG>TGG [Arg>Trp] | Hb Debao | HBA2:c.94A>T | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 33869 |
506 | CD 31 AGG>AGC [Arg>Ser] | Hb Prato | HBA2:c.96G>C | α2 | Causative | α-chain variant | NG_000006.1 | 33988 |
2209 | CD 32 ATG>AGG [Met>Arg] (Hb Gran Vía) | Hb Rotterdam | HBA2:c.98T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33990 |
367 | CD 32 G>A | Hb Amsterdam | HBA2:c.99G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33991 |
3363 | CD 33 TTC>CTC [Phe>Leu] | Hb Worthing | HBA2:c.100T>C | α2 | Causative | α-chain variant | NG_000006.1 | 33992 |
368 | CD 33 T>C | Hb Chartres | HBA2:c.101T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33993 |
3362 | CD 34 CTG>CCG [Leu>Pro] | Hb Bass Hill | HBA2:c.104T>C | α2 | Causative | α-chain variant | NG_000006.1 | 33996 |
369 | CD 35 TCC>CCC [Ser>Pro] | Hb Evora | HBA2:c.106T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33998 |
511 | CD 35 TCC>TAC [Ser>Tyr] | Hb Shinagawa | HBA2:c.107C>A | α2 | Causative | α-chain variant | NG_000006.1 | 33999 |
2999 | CD 35 TCC>TTC [Ser>Phe] | Hb Colorado | HBA2:c.107C>T | α2 | Causative | α-chain variant | NG_000006.1 | 33999 |
512 | CD 36 TTC>CTC [Phe>Leu] | Hb Geisinger | HBA2:c.109T>C | α2 | Causative | α-chain variant | NG_000006.1 | 34001 |
2373 | CD 37 CCC>TCC [Pro>Ser] | Hb Boskoop | HBA2:c.112C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34004 |
514 | CD 37 CCC>CTC [Pro>Leu] | Hb Manawatu | HBA2:c.113C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34005 |
515 | CD 37 CCC>CGC [Pro>Arg] | Hb Boumerdes | HBA2:c.113C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34005 |
516 | CD 37 +GAA [+Glu] | Hb Catonsville | HBA1:c.114_115insGAA | HBA2:c.114_115insGAA | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34006, 37810 |
2319 | CD 38 ACC>GCC [Thr>Ala] | Hb Beaconsfield | HBA1:c.115A>G | HBA2:c.115A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34007, 37811 |
3488 | CD 38 ACC>AAC [Thr>Asn] | Hb Pescara | HBA2:c.116C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34008 |
3765 | CD 39 (-ACC) [-Thr] | Hb Taybe | HBA2:c.118_120del | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34010 |
519 | CD 40 AAG>GAG [Lys>Glu] | Hb Kariya | HBA1:c.121A>G | HBA2:c.121A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34013, 37817 |
520 | CD 40 AAG>CAG [Lys>Gln] | Hb Linwood | HBA2:c.121A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34013 |
521 | CD 40 AAG>ATG [Lys>Met] | Hb Kanagawa | HBA2:c.122A>T | α2 | Causative | α-chain variant | NG_000006.1 | 34014 |
524 | CD 40 AAG>AAC [Lys>Asn] | Hb Villiers le Bel | HBA2:c.123G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34015 |
525 | CD 41 ACC>TCC or AGC [Thr>Ser] | Hb Miyano | HBA1:c.124A>T | HBA1:c.125C>G | HBA2:c.124A>T | HBA2:c.125C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34016, 37820 |
3986 | CD 41 ACC>AAC [Thr>Asn] | Hb Zhuhai | HBA2:c.125C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34017 |
373 | CD 42 TAC>CAC [Tyr>His] | Hb Barika | HBA2:c.127T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34019 |
3489 | CD 42 TAC>GAC [Tyr>Asp] | Hb Huaxi | HBA2:c.127T>G | α2 | Causative | α-chain variant | NG_000006.1 | 34019 |
3801 | CD 42 TAC>TGC [Tyr>Cys] | Hb Hauteluce | HBA2:c.128A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34020 |
527 | CD 43 TTC>GTC [Phe>Val] | Hb Torino | HBA1:c.130T>G | HBA2:c.130T>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34022, 37826 |
528 | CD 43 TTC>ATC [Phe>Ile] | Hb Sens | HBA2:c.130T>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34022 |
529 | CD 43 TTC>TTG [Phe>Leu] | Hb Hirosaki | HBA2:c.132C>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34024 |
3382 | CD 44 CCG>TCG [Pro>Ser] | Hb Xuchang | HBA2:c.133C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34025 |
3763 | CD 44 CCG>GCG [Pro>Ala] | Hb Milne | HBA2:c.133C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34025 |
532 | CD 44 CCG>CGG [Pro>Arg] | Hb Kawachi | HBA1:c.134C>G | HBA2:c.134C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34026, 37830 |
533 | CD 44 CCG>CTG [Pro>Leu] | Hb Milledgeville | HBA2:c.134C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34026 |
534 | CD 45 CAC>TAC [His>Tyr] | Hb Matsudo | HBA1:c.136C>T | HBA2:c.136C>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34028, 37832 |
535 | CD 45 CAC>GAC [His>Asp] | Hb Poitiers | HBA1:c.136C>G | HBA2:c.136C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34028, 37832 |
537 | CD 45 CAC>CCC [His>Pro] | Hb Oita | HBA2:c.137A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34029 |
538 | CD 45 CAC>CAG [His>Gln] | Hb Bari | HBA2:c.138C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34030 |
2541 | CD 45 CAC>CAG [His>Gln]; CD 57 GGC>CGC [Gly>Arg] | Hb Blythe Boulevard | HBA2:c.[138C>G;172G>C] | α2 | Causative | α-chain variant | NG_000006.1 | 34030, 34064 |
539 | CD 46 TTC>TTG or TTA or CTC [Phe>Leu] | Hb Rockaway | HBA1:c.139T>C | HBA1:c.141C>A | HBA1:c.141C>G | HBA2:c.139T>C | HBA2:c.141C>A | HBA2:c.141C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34031, 37835 |
540 | CD 46 TTC>GTC [Phe>Val] | Hb Hillingdon | HBA1:c.139T>G | HBA2:c.139T>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34031, 37835 |
2953 | CD 46 TTC>ATC [Phe>Ile] | Hb Brigante | HBA2:c.139T>A | α2 | Causative | α-chain variant | NG_000006.1 | 34031 |
2376 | CD 46 TTC>TCC [Phe>Ser] | Hb Lake Tapawingo | HBA2:c.140T>C | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34032 |
541 | CD 47 GAC>CAC [Asp>His] (Hb L-Ferrara, Hb Michigan-I, Hb Michigan-II, Hb Sealy, Hb Sinai) | Hb Hasharon | HBA2:c.142G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34034 |
543 | CD 47 GAC>TAC [Asp>Tyr] | Hb Kurdistan | HBA2:c.142G>T | α2 | Causative | α-chain variant | NG_000006.1 | 34034 |
4107 | CD 47 GAC>AAC [Asp>Asn] | Hb Arya | HBA2:c.142G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34034 |
544 | CD 47 GAC>GGC [Asp>Gly] (Hb Kokura , Hb L-Gaslini , Hb Mugino , Hb Tagawa-II , Hb Umi , Hb Yukuhashi-II) | Hb Beilinson | HBA1:c.143A>G | HBA2:c.143A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34035, 37839 |
545 | CD 47 GAC>GCC [Asp>Ala] | Hb Cordele | HBA1:c.143A>C | HBA2:c.143A>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34035, 37839 |
546 | CD 48 CTG>CGG [Leu>Arg] | Hb Montgomery | HBA2:c.146T>G | α2 | Causative | α-chain variant | NG_000006.1 | 34038 |
2535 | CD 48-54 -18 bp | Hb Fenton | HBA2:c.146_163delTGAGCCACGGCTCTGCCC | α2 | Causative | α-chain variant | NG_000006.1 | 34038 |
3694 | CD 48 CTG>CAG [Leu>Gln] | Hb Ijselland | HBA2:c.146T>A | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34038 |
2955 | CD 49-57 (-24bp): (-GCCACGGCTCTGCCCAGGTTAAGG) | Hb Goya | HBA2:c.149_172del | α2 | Causative | α-chain variant | NG_000006.1 | 34041 |
548 | CD 49 AGC>AGA or AGG [Ser>Arg] | Hb Savaria | HBA2:c.150C>A |HBA2:c.150C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34042 |
549 | CD 50 CAC>GAC [His>Asp] | Hb J-Sardegna | HBA2:c.151C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34043 |
2314 | CD 50 CAC>TAC [His>Tyr] | Hb South Yorkshire | HBA1:c.151C>T | HBA2:c.151C>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34043, 37847 |
551 | CD 50 CAC>CGC [His>Arg] | Hb Aichi | HBA1:c.152A>G | HBA2:c.152A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34044, 37848 |
3923 | CD 50 CAC>CCC [His>Pro] | Hb Porter Brook | HBA2:c.152A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34044 |
552 | CD 50 CAC>CAG [His>Gln] | Hb Frankfurt | HBA2:c.153C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34045 |
2511 | -α3.7;CD 50 CAC>CAG [His>Gln] (-α3.7kb Frankfurt) | Hb Frankfurt | NG_000006.1:g.34247_38050del;34045C>G | α3.7 hybrid | Causative | α-chain variant | NG_000006.1 | 34045 |
554 | CD 51 GGC>CGC [Gly>Arg] | Hb Russ | HBA2:c.154G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34046 |
2458 | CD 51 GGC>AGC [Gly>Ser] | Hb Riccarton II | HBA2:c.154G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34046 |
3397 | CD 51 GGC>TGC [Gly>Cys] | Hb Hunan | HBA2:c.154G>T | α2 | Causative | α-chain variant | NG_000006.1 | 34046 |
555 | CD 51 GGC>GAC [Gly>Asp] | Hb J-Abidjan | HBA1:c.155G>A | HBA2:c.155G>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34047, 37851 |
2423 | CD 52 TCT>GCT [Ser>Ala] | Hb Cheshire | HBA1:c.157T>G | HBA2:c.157T>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34049, 37853 |
3039 | CD 52-59 (-24bp): (-TCTGCCCAGGTTAAGGGCCACGGC) | Hb J-Biskra | HBA2: c.157_180del | α2 | Causative | α-chain variant | NG_000006.1 | 34049 |
557 | CD 52 TCT>TTT [Ser>Phe] | Hb Essex | HBA2:c.158C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34050 |
558 | CD 53 GCC>GAC [Ala>Asp] | Hb J-Rovigo | HBA2:c.161C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34053 |
2472 | CD 54 CAG>CCG [Gln>Pro] | Hb Dhaka | HBA1:c.164A>C | HBA2:c.164A>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34056, 37860 |
2397 | CD 54 CAG>CAC or CAT [Gln>His] | Hb Princes Risborough | HBA1:p.[Gln55His] | HBA2:p.[Gln55His] | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34057, 37861 |
563 | CD 55 GTT>GCT [Val>Ala] | Hb Gerland | HBA2:c.167T>C | α2 | Causative | α-chain variant | NG_000006.1 | 34059 |
564 | CD 56 AAG>GAG [Lys>Glu] | Hb Shaare Zedek | HBA2:c.169A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34061 |
565 | CD 56 AAG>AGG [Lys>Arg] | Hb Port Huron | HBA1:c.170A>G | HBA2:c.170A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34062, 37866 |
569 | CD 57 GGC>GAC [Gly>Asp] (Hb Kagoshima, Hb Nishik-I, Hb Nishik-II, Hb Nishik-III) | Hb J-Norfolk | HBA2:c.173G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34065 |
570 | CD 58 CAC>TAC [His>Tyr] (Hb M-Gothenburg, Hb M-Kiskunhalas, Hb M-Norin, Hb M-Osaka) | Hb M-Boston | HBA2:c.175C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34067 |
4072 | CD 58 CAC>AAC [His>Asn] | Hb DG-Nancheng | HBA2:c.175C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34067 |
571 | CD 58 CAC>CAA [His>Gln] | Hb Boghé | HBA2:c.177C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34069 |
2474 | CD 58 CAC>CAG [His>Gln] | Hb Flurlingen | HBA2:c.177C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34069 |
379 | CD 59 GGC>CGC [Gly>Arg] | Hb Zurich-Albisrieden | HBA2:c.178G>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34070 |
2409 | CD 59 GGC>AGC [Gly>Ser] | Hb Parma | HBA2:c.178G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34070 |
377 | CD 59 GGC>GAC [Gly>Asp] | Hb Adana | HBA2:c.179G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34071 |
575 | CD 59 GGC>GTC [Gly>Val] | Hb Tottori | HBA1:c.179G>T | HBA2:c.179G>T | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34071, 37875 |
577 | CD 60 AAG>GAG [Lys>Glu] | Hb Dagestan | HBA2:c.181A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34073 |
3987 | CD 60 AAG>AGG [Lys>Arg] | Hb Liuzhou-Liyong | HBA2:c.182A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34074 |
580 | CD 61 AAG>GAG [Lys>Glu] | Hb Miyagi | HBA1:c.184A>G | HBA2:c.184A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34076, 37880 |
581 | CD 61 AAG>ACG [Lys>Thr] | Hb J-Anatolia | HBA2:c.185A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34077 |
583 | CD 62 GTG>ATG [Val>Met] | Hb Evans | HBA2:c.187G>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34079 |
384 | CD 66 CTG>CCG [Leu>Pro] | Hb Dartmouth | HBA2:c.190T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34082 |
2362 | CD 63 GCC>GTC [Ala>Val] (Hb Aberystwyth) | Hb Nakhon Ratchsima | HBA2:c.191C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34083 |
586 | CD 64 GAC>TAC [Asp>Tyr] | Hb Persepolis | HBA1:c.193G>T | HBA2:c.193G>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34085, 37889 |
588 | CD 64 GAC>AAC [Asp>Asn] (Hb Aida) | Hb G-Waimanalo | HBA2:c.193G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34085 |
589 | CD 64 GAC>GGC [Asp>Gly] | Hb Guangzhou-Hangzhou | HBA1:c.194A>G | HBA2:c.194A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34086, 37890 |
590 | CD 65 GCG>ACG [Ala>Thr] | Hb Part-Dieu | HBA2:c.196G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34088 |
591 | CD 65 GCG>GTG [Ala>Val] | Hb Bois Guillaume | HBA1:c.197C>T | HBA2:c.197C>T | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34089, 37893 |
3381 | CD 67 ACC>ATC [Thr>Ile] | Hb Sichuan | HBA2:c.203C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34095 |
593 | CD 68 AAC>GAC [Asn>Asp] | Hb Ube-2 | HBA2:c.205A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34097 |
595 | CD 68 AAC>CAC [Asn>His] | Hb St. Truiden | HBA2:c.205A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34097 |
2318 | CD 68 AAC>TAC [Asn>Tyr] | Hb Chelmsford | HBA1:c.205A>T | HBA2:c.205A>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34097, 37901 |
596 | CD 68 AAC>AAA [Asn>Lys] (Hb D-Baltimore, Hb D-St. Louis, Hb D-Washington, Hb G-Azakouli, Hb G-Bristol, Hb G-Knoxville, Hb Stanleyville-I) | Hb G-Philadelphia | HBA2:c.207C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34099 |
3973 | -α3.7;CD 68 AAC>AAR (-α3.7-Hb G-Philadelphia) | Hb G-Philadelphia | NG_000006.1:g.[34099C>R;34247_38050del] | α2, α3.7 hybrid | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34099, 34247 |
598 | CD 69 GCC>ACC [Ala>Thr] | Hb Decines-Charpieu | HBA2:c.208G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34100 |
2335 | CD 70 GTG>GGG [Val>Gly] | Hb Edinburgh | HBA2:c.212T>G | α2 | Causative | α-chain variant | NG_000006.1 | 34104 |
2312 | CD 71 GCG>ACG [Ala>Thr] | Hb Hatfield | HBA1:c.214G>A | HBA2:c.214G>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34106, 37910 |
600 | CD 71 GCG>GAG [Ala>Glu] | Hb J-Habana | HBA1:c.215C>A | HBA2:c.215C>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34107, 37911 |
602 | CD 72 CAC>GAC [His>Asp] | Hb Norton | HBA2:c.217C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34109 |
603 | CD 72 CAC>TAC [His>Tyr] (Hb Tanashi) | Hb Fuchu-I | HBA1:c.217C>T | HBA2:c.217C>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34109, 37913 |
604 | CD 72 CAC>CGC [His>Arg] | Hb Daneshgah-Tehran | HBA2:c.218A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34110 |
605 | CD 72 CAC>CAA [His>Gln] | Hb Gouda | HBA2:c.219C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34111 |
606 | CD 74 GAC>AAC [Asp>Asn] | Hb G-Pest | HBA2:c.223G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34115 |
2979 | CD 74 GAC>TAC [ Asp>Tyr] | Hb Uttoxeter | HBA2:c.223G>T | α2 | Causative | α-chain variant | NG_000006.1 | 34115 |
610 | CD 74 GAC>GCC [Asp>Ala] | Hb Lille | HBA1:c.224A>C | HBA2:c.224A>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34116, 37920 |
3749 | CD 74 GAC>GGC [Asp>Gly] (Hb Chapel Hill) | Hb Liangqing | HBA2:c224A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34116 |
611 | CD 75 (-GAC) | Hb Watts | HBA2:c.226_228del | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34118 |
612 | CD 75 GAC>AAC [Asp>Asn] | Hb Matsue-Oki | HBA2:c.226G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34118 |
613 | CD 75 GAC>CAC [Asp>His] | Hb Q-Iran | HBA2:c.226G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34118 |
614 | CD 75 GAC>TAC [Asp>Tyr] | Hb Winnipeg | HBA2:c.226G>T | α2 | Causative | α-chain variant | NG_000006.1 | 34118 |
615 | CD 75 GAC>GTC [Asp>Val] | Hb Al-Hammadi Riyadh | HBA2:c.227A>T | α2 | Causative | α-chain variant | NG_000006.1 | 34119 |
616 | CD 75 GAC>GGC [Asp>Gly] | Hb Mizushi | HBA2:c.227A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34119 |
617 | CD 76 ATG>AGG [Met>Arg] | Hb Walpole | HBA1:c.230T>G | HBA2:c.230T>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34122, 37926 |
618 | CD 76 ATG>ACG [Met>Thr] | Hb Aztec | HBA2:c.230T>C | α2 | Causative | α-chain variant | NG_000006.1 | 34122 |
619 | CD 76 ATG>AAG [Met>Lys] | Hb Noko | HBA1:c.230T>A | HBA2:c.230T>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34122, 37926 |
620 | CD 76 ATG>ATA [Met>Ile] | Hb Hellux | HBA2:c.231G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34123 |
2486 | CD 77 CCC>TCC [Pro>Ser] | Hb Nile | HBA2:c.232C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34124 |
621 | CD 77 CCC>CAC [Pro>His] | Hb Toulon | HBA2:c.233C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34125 |
622 | CD 77 CCC>CTC [Pro>Leu] | Hb Asklipios | HBA2:c.233C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34125 |
623 | CD 77 CCC>CGC [Pro>Arg] | Hb GuiZhou | HBA1:c.233C>G | HBA2:c.233C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34125, 37929 |
624 | CD 78 AAC>GAC [Asn>Asp] | Hb J-Singa | HBA1:c.235A>G | HBA2:c.235A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34127, 37931 |
626 | CD 78 AAC>AAG or AAA [Asn>Lys] | Hb Stanleyville-II | HBA2:c.[237C>A ;237C>G] | α2 | Causative | α-chain variant | NG_000006.1 | 34129 |
627 | CD 79 GCG>ACG [Ala>Thr] | Hb Mantes-La-Jolie | HBA1:c.238G>A | HBA2:c.238G>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34130, 37934 |
628 | CD 79 GCG>GGG [Ala>Gly] | Hb J-Singapore | HBA2:c.239C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34131 |
629 | CD 80 CTG>GTG [Leu>Val] | Hb Conakry | HBA2:c.241C>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34133 |
630 | CD 80 CTG>CGG [Leu>Arg] | Hb Ann Arbor | HBA2:c.242T>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34134 |
3800 | CD 80 CTG>CCG [Leu>Pro] | Hb Robbinsdale | HBA2:c.242T>C | α2 | Causative | α-chain variant | NG_000006.1 | 34134 |
631 | CD 81 TCC>CCC [Ser>Pro] | Hb Passy | HBA2:c.244T>C | α2 | Causative | α-chain variant | NG_000006.1 | 34136 |
2980 | CD 81 TCC>TAC [Ser>Tyr] | Hb Wolverhampton | HBA2:c.245C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34137 |
3884 | CD 81 TCC>TTC [Ser>Phe] | Hb Zhaotong | HBA2:c.245C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34137 |
634 | CD 82 GCC>GAC [Ala>Asp] | Hb Garden State | HBA1:c.248C>A | HBA2:c.248C>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34140, 37944 |
635 | CD 83 CTG>CCG [Leu>Pro] | Hb Les Andelys | HBA2:c.251T>C | α2 | Causative | α-chain variant | NG_000006.1 | 34143 |
636 | CD 84 AGC>GGC [Ser>Gly] | Hb Wembley | HBA1:c.253A>G | HBA2:c.253A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34145, 37949 |
638 | CD 84 AGC>AAC [Ser>Asn] | Hb Meulan | HBA2:c.254G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34146 |
2970 | CD 84 AGC>ACC [Ser>Thr] | Hb Oelsnitz | HBA2:c.254G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34146 |
640 | CD 85 GAC>TAC [Asp>Tyr] | Hb Atago | HBA1:c.256G>T | HBA2:c.256G>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34148, 37952 |
2446 | CD 85 GAC>CAC [Asp>His] | Hb Canuts II | HBA2:c.256G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34148 |
3952 | CD 85 GAC>AAC [Asp>Asn] | Hb G-Norfolk | HBA2:c.256G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34148 |
642 | CD 85 GAC>GTC [Asp>Val] | Hb Inkster | HBA2:c.257A>T | α2 | Causative | α-chain variant | NG_000006.1 | 34149 |
2355 | CD 85 GAC>GGC [Asp>Gly] | Hb Benton | HBA2:c.257A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34149 |
2398 | CD 85 GAC>GAA or GAG [Asp>Glu] | Hb Aylesbury | HBA1:c.258C>A | HBA1:c.258C>G | HBA2:c.258C>A | HBA2:c.258C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34150, 37954 |
2372 | CD 86 CTG>GTG [Leu>Val] | Hb Ridgewood | HBA2:c.259C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34151 |
643 | CD 86 CTG>CGG [Leu>Arg] | Hb Moabit | HBA1:c.260T>G | HBA2:c.260T>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34152, 37956 |
644 | CD 87 +9 bp [+Ser-Asp-Leu] | Hb Neuilly-sur-Marne | HBA1:c.253_261dup | HBA2:c.253_261dup | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34154, 37949 |
645 | CD 87 CAC>TAC [His>Tyr] (Hb M-Kankakee, Hb M-Oldenburg, Hb M-Sendai) | Hb M-Iwate | HBA2:c.262C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34154 |
646 | CD 87 CAC>AAC [His>Asn] | Hb Auckland | HBA1:c.262C>A | HBA2:c.262C>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34154, 37958 |
648 | CD 87 CAC>CGC [His>Arg] | Hb Iwata | HBA1:c.263A>G | HBA2:c.263A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34155, 37959 |
2308 | CD 87 CAC>CAG [His>Gln] | Hb Lansing | HBA2:c.264C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34156 |
2549 | CD 87 CAC>CAA [His>Glu] | Hb Lansing (A) | HBA2:c.264C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34156 |
650 | CD 88 GCG>TCG [Ala>Ser] | Hb Loire | HBA1:c.265G>T | HBA2:c.265G>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34157, 37961 |
2367 | CD 88 GCG>ACG [Ala>Thr] | Hb Voorhees | HBA2:c.265G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34157 |
651 | CD 88 GCG>GAG [Ala>Glu] | Hb Wroclaw | HBA1:c.266C>A | HBA2:c.266C>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34158, 37962 |
652 | CD 88 GCG>GTG [Ala>Val] | Hb Columbia Missouri | HBA1:c.266C>T | HBA2:c.266C>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34158, 37962 |
653 | CD 88 GCG>GGG [Ala>Gly] | Hb Valparaiso | HBA1:c.266C>G | HBA2:c.266C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34158, 37962 |
654 | CD 89 CAC>TAC [His>Tyr] | Hb Villeurbanne | HBA2:c.268C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34160 |
655 | CD 89 CAC>CCC [His>Pro] | Hb Tokyo | HBA1:c.269A>C | HBA2:c.269A>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34161, 37965 |
656 | CD 89 CAC>CGC [His>Arg] | Hb Tamano | HBA1:c.269A>G | HBA2:c.269A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34161, 37965 |
657 | CD 89 CAC>CTC [His>Leu] | Hb Luton | HBA2:c.269A>T | α2 | Causative | α-chain variant | NG_000006.1 | 34161 |
2390 | CD 89 CAC>CAG [His>Gln] | Hb Enfield | HBA2:c.270C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34162 |
659 | CD 90 AAG>GAG [Lys>Glu] | Hb Sudbury | HBA1:c.271A>G | HBA2:c.271A>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34163, 37967 |
2388 | CD 90 AAG>CAG [Lys>Gln] | Hb Bergerac | HBA2:c.271A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34163 |
660 | CD 90 AAG>ATG [Lys>Met] (Hb Munakata) | Hb Handa | HBA1:c.272A>T | HBA2:c.272A>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34164, 37968 |
661 | CD 90 AAG>AGG [Lys>Arg] | Hb Clinico-Madrid | HBA2:c.272A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34164 |
664 | CD 90 AAG>AAT (Hb Tagawa-I) | Hb J-Broussais | HBA2:c.273G>T | α2 | Causative | α-chain variant | NG_000006.1 | 34165 |
2311 | CD 91 CTT>TTT [Leu>Phe] | Hb Treviso | HBA2: c.274C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34166 |
2470 | CD 91 CTT>ATT [Leu>Ile] | Hb Zara | HBA2:c.274C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34166 |
666 | CD 91 CTT>CCT [Leu>Pro] | Hb Port Phillip | HBA2:c.275T>C | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34167 |
2952 | CD 91 CTT>CGT [Leu>Arg] | Hb La Mancha | HBA2:c.275T>G | α2 | Causative | α-chain variant | NG_000006.1 | 34167 |
2956 | CD 91 CTT>CAT [Leu>His] | Hb Kalavasos | HBA2:c.275T>A | α2 | Causative | α-chain variant | NG_000006.1 | 34167 |
667 | CD 92 CGG>TGG [Arg>Trp] | Hb Cemenelum | HBA1:c.277C>T | HBA2:c.277C>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34169, 37973 |
3587 | CD 92 CGG>GGG [Arg>Gly] | Hb Leeuwarden | HBA2:c.277C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34169 |
669 | CD 92 CGG>CTG [Arg>Leu] | Hb Chesapeake | HBA2:c.278G>T | α2 | Causative | α-chain variant | NG_000006.1 | 34170 |
670 | CD 92 CGG>CCG [Arg>Pro] | Hb Monou | HBA2:c.278G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34170 |
389 | CD 93 GTG>GGG [Val>Gly] | Hb Bronte | HBA2:c.281T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34173 |
673 | CD 94 GAC>TAC [Asp>Tyr] | Hb Setif | HBA2:c.283G>T | α2 | Causative | α-chain variant | NG_000006.1 | 34175 |
674 | CD 94 GAC>AAC [Asp>Asn] | Hb Titusville | HBA2:c.283G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34175 |
675 | CD 94 GAC>CAC [Asp>His] | Hb Sunshine Seth | HBA2:c.283G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34175 |
676 | CD 94 GAC>GTC [Asp>Val] | Hb Kirksey | HBA2:c.284A>T | α2 | Causative | α-chain variant | NG_000006.1 | 34176 |
679 | CD 94 GAC>GAG [Asp>Glu] | Hb Roanne | HBA1:c.285C>G | HBA2:c.285C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34177, 37981 |
680 | CD 95 CCG>GCG [Pro>Ala] | Hb Denmark Hill | HBA2:c.286C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34178 |
682 | CD 95 CCG>TCG [Pro>Ser] | Hb Rampa | NM_000517.4(HBA2):c.286C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34178 |
683 | CD 95 CCG>CTG [Pro>Leu] | Hb G-Georgia | HBA2:c.287C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34179 |
2375 | CD 96 GTC>ATC [Vla>Ile] | Hb El Salvador | HBA2:c.289G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34181 |
686 | CD 96 GTC>GAC [Val>Asp] | Hb El Escorial | HBA2:c.290T>A | α2 | Causative | α-chain variant | NG_000006.1 | 34182 |
687 | CD AAC>CAC [Asn>His] (Hb Shinbashi) | Hb Fuchu-II | HBA2:c.292A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34184 |
2350 | CD 97 AAC>GAC [Asn>Asp] | Hb Cheektowaga | HBA2:c.292A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34184 |
688 | CD 97 AAC>AAA [Asn>Lys] | Hb Dallas | HBA2:c.294C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34186 |
3988 | CD 98 TTC>GTC [Phe>Val] | Hb Xiangzhou | HBA2:c.295T>G | α2 | Causative | α-chain variant | NG_000006.1 | 34187 |
689 | CD 98 TTC>TAC [Phe>Tyr] | Hb Mill Hill | HBA1:c.296T>A | HBA2:c.296T>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34188, 37992 |
2466 | CD 99 AAG>CAG [Lys>Gln] | Hb Burkina Fassa | HBA2:c.298A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34190 |
2416 | CD 99 AAG>ATG [Lys>Met] | N/A | HBA1:c.299A>T | α1 | Causative | α-chain variant | NG_000006.1 | 34191 |
2424 | CD 99 AAG>AGG [Lys>Arg] | Hb Papanui | HBA2:c.299A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34191 |
2370 | CD 99 AAG>AAC [Lys>Asn] | Hb Fulton | HBA2:c.300G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34192 |
2220 | CD 101 CTA>CCA [Leu>Pro] | Hb Bishopstown | HBA2:c.305T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34339 |
692 | CD 102 AGC>CGC [Ser>Arg] | Hb Manitoba I | HBA2:c.307A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34341 |
2304 | CD 102 AGC>AAC (Ser>Asn) | Hb Enschede | HBA2:c.308G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34342 |
694 | CD 102 AGC>AGA [Ser>Arg] | Hb Manitoba III | HBA2:c.309C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34343 |
696 | CD 103 CAC>TAC [His>Tyr] | Hb Lombard | HBA2:c.310C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34344 |
394 | CD 103 CAC>CTC [His>Leu] | Hb Bronovo | HBA2:c.311A>T | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34345 |
698 | CD 103 CAC>CGC [His>Arg] | Hb Contaldo | HBA1:c.311A>G | HBA2:c.311A>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34345, 38156 |
2420 | CD 104 TGC>CGC [Cys>Arg] | Hb Iberia | HBA2:c.313T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34347 |
3056 | CD 104 TGC>AGC [Cys>Ser] | Hb Oegstgeest | HBA2:c.313T>A | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34347 |
396 | CD 104 TGC>TAC [Cys>Tyr] | Hb Sallanches | HBA2:c.314G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34348 |
3583 | CD 106 CTG>CGG [Leu>Arg] | Hb Beckett | HBA2:c.320T>G | α2 | Causative | α-chain variant | NG_000006.1 | 34354 |
3913 | CD 107 GTG>CTG [Val>Leu] | Hb Liaobu | HBA2:c.322G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34356 |
2436 | CD 107 GTG>G-G | Hb Lynwood | HBA2:c.323delT | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34357 |
4078 | CD 108 ACC>CCC [Thr>Pro] | N/A | HBA1:c.325A>C | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34359 |
397 | CD 108 ACC>AAC [Thr>Asn] | Hb Bleuland | HBA2:c.326C>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34360 |
2991 | CD 108 ACC>AAC [Thr>Asn] | Hb Rogliano | HBA1:c.326C>A | α1 | Causative | α-chain variant | NG_000006.1 | 34360 |
398 | CD 109 (-C) | Hb Sciacca | HBA1:c.328delC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34362 |
399 | CD 109 CTG>CGG [Leu>Arg] | Hb Suan Dok | HBA2:c.329T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34363 |
2571 | CD 109 CTG>CCG [Leu>Pro] | Hb Milano | HBA1:c.329T>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34363 |
704 | CD 110 GCC>ACC [Ala>Thr] | Hb Tonosho | HBA1:c.331G>A | HBA2:c.331G>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34365, 38176 |
401 | CD 110 GCC>GAC [Ala>Asp] | Hb Petah Tikva | HBA1:c.332C>A | HBA2:c.332C>A | α1 or α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34366 |
706 | CD 111 GCC>ACC [Ala>Thr] | Hb Mosella | HBA1:c.334G>A | HBA2:c.334G>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34368, 38179 |
3982 | CD 111 GCC>TCC [Ala>Ser] | Hb Liuzhou-Yufeng | HBA1:c.334G>T | α1 | Causative | α-chain variant | NG_000006.1 | 34368 |
707 | CD 111 GCC>GTC [Ala>Val] | Hb Anamosa | HBA2:c.335C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34369 |
721 | CD 116-117 +15 bp [+His-Leu-Pro-Ala-Glu] | Hb Zaïre | HBA1:c.337_351dup | HBA2:c.337_351dup | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34371, 38182 |
2360 | CD 112 CAC>TAC [His>Tyr] | Hb Kansas City | HBA2:c.337C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34371 |
2366 | CD 112 CAC>AAC [His>Asn] | Hb Royal Oak | HBA2:c.337C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34371 |
709 | CD 112 CAC>CGC [His>Arg] (Hb Serbia) | Hb Strumica | HBA1:c.338A>G | HBA2:c.338A>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34372, 38183 |
3924 | CD 112 CAC>CCC [His>Pro] | Hb Beligneux | HBA2:c.338A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34372 |
404 | CD 113-116 (-12 bp) & CD 112 (C>G) | Hb Leida | HBA2:c.[339C>G;340_351delCTCCCCGCCGAG] | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34373 |
3482 | CD 113 CTC>TTC [Leu>Phe] | Hb Pretoria | HBA2:c.340C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34374 |
711 | CD 113 CTC>CGC [Leu>Arg] | Hb San Antonio | HBA2:c.341T>G | α2 | Causative | α-chain variant | NG_000006.1 | 34375 |
712 | CD 113 CTC>CAC [Leu>His] | Hb Twin Peaks | HBA1:c.341T>A | HBA2:c.341T>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34375, 38186 |
713 | CD 114 CCC>TCC [Pro>Ser] | Hb Melusine | NM_000517.6(HBA2):c.343C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34377 |
714 | CD 114 CCC>ACC [Pro>Thr] (Hb Bamako) | Hb Jura | HBA2:c.343C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34377 |
716 | CD 114 CCC>CGC [Pro>Arg] | Hb Chiapas | HBA1:c.344C>G | HBA2:c.344C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34378, 38189 |
2369 | CD 115 -GCC [-Ala] | Hb Towson | HBA2:c.346_348delGCC | α2 | Causative | α-chain variant | NG_000006.1 | 34380 |
717 | CD 115 GCC>GAC [Ala>Asp] | Hb J-Tongariki | HBA1:c.347C>A | HBA2:c.347C>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34381, 38192 |
718 | CD 116 GAG>CAG [Glu>Gln] | Hb Oleander | HBA1:c.349G>C | HBA2:c.349G>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34383, 38194 |
3041 | CD 116 GAG>AAG [Glu>Lys] | Hb O-Indonesia | HBA2:c.349G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34383 |
2337 | CD 116 GAG>GTG [Glu>Val] | Hb Walsgrave | HBA2:c.350A>T | α2 | Causative | α-chain variant | NG_000006.1 | 34384 |
722 | CD 117 TTC>ATC [Phe>Ile] | Hb Ambroise Pare | HBA2:c.352T>A | α2 | Causative | α-chain variant | NG_000006.1 | 34386 |
2023 | CD 117 TTC>TCC [Phe>Ser] | Hb Foggia | HBA2:c.353T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34387 |
3970 | CD 117 TTC>TTG [Phe>Leu] | Hb Jendouba | HBA2:c.354C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34388 |
2951 | CD 118 ACC>ATC [Thr>Ile] | Hb Cervantes | HBA2:c.356C>T | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34390 |
3028 | CD 119 CCT>TCT [Pro>Ser] | Hb Macarena | HBA2:c.358C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34392 |
3271 | CD 119 CCT>GCT [Pro>Ala] (Hb Lakeview Terrace) | Hb Arcadia | HBA2:c.358C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34392 |
3716 | CD 119 CCT>CAT [Pro>His] | N/A | HBA2:c.359C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34393 |
727 | CD 120 GCG>GAG [Ala>Glu] (Hb J-Birmingham) | Hb J-Meerut | HBA2:c.362C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34396 |
3029 | CD 121 (+3bp): (+GTG) | Hb El Retiro | HBA2:c.364_366dupGTG | α2 | Causative | α-chain variant | NG_000006.1 | 34398 |
3042 | CD 122 CAC>TAC [His>Tyr] | Hb Yanase | HBA2:c.367C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34401 |
2356 | CD 122 CAC>CTC [His>Leu] | Hb Dubai | HBA2:c.368A>T | α2 | Causative | α-chain variant | NG_000006.1 | 34402 |
730 | CD 122 CAC>CAG [His>Gln] | Hb Westmead | HBA2:c.369C>G | α2 | Causative | α-chain variant | NG_000006.1 | 34403 |
3961 | CD 122/123 (-CG,+GA) | Hb Nanning | HBA2:c.369_370delinsGA | α2 | Causative | α-chain variant | NG_000006.1 | 34403 |
731 | CD 123 GCC>ACC [Ala>Thr] (Hb Croxley Green) | Hb Santa Barnabas | HBA2:c.370G>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34404 |
2457 | CD 123 GCC>GTC [Ala>Val] | Hb Pressath | HBA2:c.371C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34405 |
734 | CD 124 TCC>CCC [Ser>Pro] | Hb Policoro | HBA2:c.373T>C | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34407 |
3748 | CD 124 TCC>ACC [Ser>Thr] | Hb Huadu | HBA2:c.373T>A | α2 | Causative | α-chain variant | NG_000006.1 | 34407 |
2444 | CD 124 TCC>TTC [Ser>Phe] | Hb Batley | HBA1:c.374C>T | HBA2:c.374C>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34408, 38219 |
408 | CD 125 CTG>CCG [Leu>Pro] | Hb Quong Sze | HBA2:c.377T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34411 |
409 | CD 125 CTG>CGG [Leu>Arg] | Hb Plasencia | HBA2:c.377T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34411 |
736 | CD 125 CTG>CAG [Leu>Gln] | Hb West-Einde | HBA2:c.377T>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34411 |
3758 | CD 126 GAC>AAC [Asp>Asn] | Hb Tarrant | HBA2:c.379G>A | α2 | Causative | α-chain variant | NG_000006.1 | 34413 |
741 | CD 126 GAC>GGC [Asp>Gly] | Hb West One | HBA2:c.380A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34414 |
742 | CD 126 GAC>GGC [Asp>Val] | Hb Fukutomi | HBA1:c.380A>T | HBA2:c.380A>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34414, 38225 |
2338 | CD 127 AAG>GAG [Lys>Glu] | Hb Coombe Park | HBA2:c.382A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34416 |
744 | CD 127 AAG>ACG [Lys>Thr] | Hb St. Claude | HBA1:c.383A>C | HBA2:c.383A>C | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34417, 38228 |
2530 | CD 127 AAG>AGG [Lys>Arg] | Hb Longview | HBA2:c.383A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34417 |
745 | CD 127 AAG>AAT or AAC [Lys>Asn] | Hb Jackson | HBA1:c.384G>C | HBA1:c.384G>T | HBA2:c.384G>C | HBA2:c.384G>T | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34418, 38229 |
2480 | CD 129 CTG>-TG | Hb Hamilton Hill | HBA2:c.388delC | α2 | Causative | α-chain variant | NG_000006.1 | 34422 |
412 | CD 129 CTG>CCG [Leu>Pro] | Hb Utrecht | HBA2:c.389T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34423 |
413 | CD 130 GCT>CCT [Ala>Pro] | Hb Sun Prairie | HBA2:c.391G>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34425 |
750 | CD 130 GCT>GAT [Ala>Asp] | Hb Yuda | HBA2:c.392C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34426 |
414 | CD 131 TCT>CCT [Ser>Pro] | Hb Questembert | HBA2:c.394T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34428 |
415 | CD 132 GTG>GGG [Val>Gly] | Hb Caen | HBA1:c.398T>G | HBA2:c.398T>G | α1 or α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34432 |
4085 | CD 132 (+T) | Hb Balkh | HBA2:c.398dup | α2 | Causative | α-chain variant | NG_000006.1 | 34432 |
3404 | CD 133-135 (-AGCACCG) | Hb Aalesund | HBA2:c.400_406del | α2 | Causative | α-chain variant | NG_000006.1 | 34434 |
756 | CD 133 AGC>AAC [Ser>Asn] | Hb Saclay | HBA1:c.401G>A | HBA2:c.401G>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34435, 38246 |
757 | CD 133 AGC>AGA [Ser>Arg] (Hb Footscray) | Hb Val de Marne | HBA2:c.402C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34436 |
758 | CD 134 ACC>GCC [Thr>Ala] | Hb Brunswick | HBA2:c.403A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34437 |
759 | CD 134 ACC>AGC or TCC [Thr>Ser] | Hb Kenton | HBA1:c.403A>T | HBA1:c.404C>G | HBA2:c.403A>T | HBA2:c.404C>G | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34437, 34438, 38248, 38249 |
761 | CD 135 GTG>CTG [Val>Leu] | Hb Tottenham | HBA2:c.406G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34440 |
764 | CD 136 CTG>ATG [Leu>Met] | Hb Chicago | HBA2:c.409C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34443 |
417 | CD 136 CTG>CCG [Leu>Pro] | Hb Bibba | HBA2:c.410T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34444 |
766 | CD 136 CTG>CGG [Leu>Arg] | Hb Toyama | HBA1:c.410T>G | HBA2:c.410T>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34444, 38255 |
2540 | CD 137-138 ACCTCC>ACTCTC | Hb Pohnpei | HBA2:c.414_416delinsTCT | α2 | Causative | α-chain variant | NG_000006.1 | 34448 |
768 | CD 138 TCC>CCC [Ser>Pro] | Hb Attleboro | HBA1:c.415T>C | HBA2:c.415T>C | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34449, 38260 |
770 | CD 138 TCC>TTC [Ser>Phe] | Hb Frauenfeld | HBA2:c.416C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34450 |
772 | CD 139 AAA>GAA [Lys>Glu] | Hb Hanamaki-2 | HBA2:c.418A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34452 |
3379 | CD 139 AAA>CAA [Lys>Gln] | Hb Jilin | HBA2:c.418A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34452 |
2981 | CD 139 AAA>AGA [Lys>Arg] | Hb Witham | HBA2:c.419A>G | α2 | Causative | α-chain variant | NG_000006.1 | 34453 |
774 | CD 139 AAA>AAC [Lys>Asn] | Hb Fukui | HBA2:c.420A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34454 |
775 | CD 139 (-A) | Hb Wayne | HBA2:c.420delA | α2 | Causative | α-chain variant | NG_000006.1 | 34454 |
3712 | CD 140 TAC>TCC [Tyr>Ser] | Hb Angers | HBA2:c.422A>C | α2 | Causative | α-chain variant | NG_000006.1 | 34456 |
777 | CD 140 TAC>TAA | Hb Natal | HBA2:c.423C>A | α2 | Causative | α-chain variant | NG_000006.1 | 34457 |
778 | CD 141 CGT>CAT [Arg>Ser] | Hb J-Cubujuqui | HBA1:c.424C>A | HBA2:c.424C>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 34458, 38269 |
780 | CD 141 CTG>TGT [Arg>Cys] | Hb Nunobiki | HBA2:c.424C>T | α2 | Causative | α-chain variant | NG_000006.1 | 34458 |
781 | CD 141 CGT>CCT [Arg>Pro] | Hb Singapore | HBA2:c.425G>C | α2 | Causative | α-chain variant | NG_000006.1 | 34459 |
418 | CD 142 (TAA>CAA) >172aa | Hb Constant Spring | HBA2:c.427T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34461 |
419 | CD 142 (TAA>AAA) >172aa | Hb Icaria | HBA2:c.427T>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34461 |
421 | CD 142 (TAA>GAA) >172aa | Hb Seal Rock | HBA2:c.427T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34461 |
785 | CD 142 TAA>CAA>CAT | Hb Zurich-Altstetten | HBA2:c.[427T>C;429A>T] | α2 | Causative | α-chain variant | NG_000006.1 | 34461 |
420 | CD 142 TAA>TCA >172aa | Hb Koya Dora | HBA2:c.428A>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34462 |
2526 | CD 142 TAA>TTA >172aa | Hb Kinshasa | HBA2:c.428A>T | α2 | Causative | α-chain variant | NG_000006.1 | 34462 |
422 | CD 142 (TAA>TAT) >172aa | Hb Paksé | HBA2:c.429A>T | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34463 |
3805 | Poly A (AATAAA>AATAAG);CD 94 (+21 bp duplication) | N/A | NG_000006.1:g.[34557A>G;37979_379996dup] | α2 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 34557 |
429 | CD 1 GTG>TTG [Val>Leu] | Hb Baldock | HBA1:c.4G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37583 |
435 | CD 2 CTG>CGG [Leu>Arg] | Hb Chongqing | HBA1:c.8T>G | α1 | Causative | α-chain variant | NG_000006.1 | 37587 |
3699 | CD 2 CTG>CCG [Leu>Pro] | Hb Kaiser West End | HBA1:c.8T>C | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37587 |
2352 | CD 2/3 +CTG [+Leu] | Hb Pittsburgh | HBA1:c.9_10insCTG | α1 | Causative | α-chain variant | NG_000006.1 | 37588 |
437 | CD 3 TCT>TTT [Ser>Phe] | Hb Douala | HBA1:c.11C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37590 |
3981 | CD 5 GCC>ACC [Ala>Thr] | Hb Hengqin I | HBA1:c.16G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37595 |
441 | CD 5 GCC>GAC [Ala>Asp] | Hb J-Toronto | HBA1:c.17C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37596 |
442 | CD 6 GAC>TAC [Asp>Tyr] | Hb Woodville | HBA1:c.19G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37598 |
444 | CD 6 GAC>CAC [Asp>His] | Hb Galliera I | HBA1:c.19G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37598 |
3922 | CD 6 GAC>GAG [Asp>Glu] | Hb Brammer | HBA1:c.21C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37600 |
450 | CD 7 AAG>GAG [Lys>Glu] | Hb Kurosaki | HBA1:c.22A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37601 |
2987 | CD 9 AAC>GAC [Asn>Asp] | Hb Farnborough | HBA1:c.28A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37607 |
453 | CD 9 AAC>AGC [Asn>Ser] | Hb Anadour | HBA1:c.29A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37608 |
456 | CD 9 AAC>AAG or AAA [Asn>Lys] | Hb Delfzicht | HBA1:c.30C>G | HBA1:c.30C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37609 |
3953 | CD 11 AAG>CAG [Lys>Gln] | Hb J-Wenchang-Wuming | HBA1:c.34A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37613 |
461 | CD 12 GCC>GAC [Ala>Asp] (Hb J-Aljezur) | Hb J-Paris-I | HBA2:c.38C>A | α2 | Causative | α-chain variant | NG_000006.1 | 37617 |
2386 | CD 13 GCC>ACC [Ala>Thr] | Hb Olivet | HBA1:c.40G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37619 |
347 | CD 14 TGG>CGG [Trp>Arg] | Hb Evanston | HBA1:c.43T>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37622 |
2380 | CD 14 TGG>TTG [Trp>Leu] | Hb Basel | HBA1:c.44G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37623 |
465 | CD 15 GGT>CGT [Gly>Arg] (Hb Siam) | Hb Ottawa | HBA1:c.46G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37625 |
2365 | CD 15 GGT>TGT [Gly>Cys] | Hb St. Rose | HBA1:c.46G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37625 |
466 | cd 15 GGT>GAT [Gly>Asp] (Hb J-Oxford , Hb N-Cosenza) | Hb I-Interlaken | HBA1:c.47G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37626 |
2509 | CD 16 AAG>GAG [Lys>Glu] (Hb I-Burlington, Hb I-Philadelphia, Hb I-Skamania, Hb I-Texas) | HbI | HBA1:c.49A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37628 |
468 | CD 16 AAG>ATG [Lys>Met] | Hb Harbin | HBA1:c.50A>T | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37629 |
471 | CD 18 GGC>CGC [Gly>Arg] | Hb Handsworth | HBA1:c.55G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37634 |
2353 | CD 18 GGC>TGC [Gly>Cys] | Hb Lima | HBA1:c.55G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37634 |
3000 | CD 18 GGC>AGC [ Gly>Ser] | Hb King Ecgbert | HBA1:c.55G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37634 |
2205 | CD 20 +T | N/A | HBA1:c.62_63insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37641 |
2285 | CD 20 CAC>CCC [His>Pro] (Hb Anderlecht) | Hb Fulton-Georgia | HBA1:c.62A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37641 |
2317 | CD 20 CAC>CAA [His>Gln] (Hb Le Lamentin) | Hb Brugg | HBA1:c.63C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37642 |
4102 | CD 20 CAC>CAG [His>Gln] | Hb Ormylia | HBA1:c.63C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37642 |
482 | CD 21 GCT>GAT [Ala>Asp] | Hb J-Nyanza | HBA1:c.65C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37644 |
3757 | CD 23 GAG>CAG [Glu>Gln] | Hb Memphis | HBA1:c.70G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37649 |
491 | CD 24 TAT>TGT [Tyr>Cys] | Hb Ramona | HBA1:c.74A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37653 |
3954 | CD 16 AAG>AAC [Lys>Asn] | Hb Beijing | HBA1:c.51G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37656 |
2510 | CD 27 GAG>GAC [Glu>Asp] | Hb Hekinan | HBA1:c.84G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37663 |
2983 | CD 27 GAG>GAT [Glu>Asp] | Hb Hekinan II | HBA1:c.84G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37663 |
2995 | CD 28 GCC>ACC [Ala>Thr] | Hb Bramall Lane | HBA1:c.85G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37664 |
2313 | CD 28 GCC>GTC [Ala>Val] | Hb Nedlands | HBA1:c.86C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37665 |
2310 | CD 29 CTG>GTG [Leu>Val] | Hb Kosovo | HBA1:c.88C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37667 |
502 | CD 30 GAG>CAG [Glu>Gln] (Hb G-Chinese, Hb G-Hong Kong, Hb G-Singapore) | Hb G-Honolulu | NM_000558.5(HBA1):c.91G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37670 |
3767 | CD 30 GAG>AAG [Glu>Lys] | Hb O-Padova | HBA1:c.91G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37670 |
504 | CD 30 GAG>GCG [Glu>Ala] | Hb Bom Jesus da Lapa | HBA1:c.92A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37671 |
505 | CD 30 GAG>GTG [Glu>Val] | Hb Itapira | HBA1:c.92A>T | α1 | Causative | α-chain variant | NG_000006.1 | 37671 |
2402 | CD 31 AGG>ACG [Arg>Thr] | Hb Mao | HBA1:c.95G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37674 |
2381 | CD 32 ATG>AAG [Met>Lys] (Hb Chao Pra Ya) | Hb Queens Park | HBA1:c.98T>A | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37794 |
2986 | CD 32 ATG>ACG [Met>Thr] | Hb Bridlington | HBA1:c.98T>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37794 |
3252 | CD 32 ATG>ATA [Met>Ile] | Hb Amsterdam-A1 | HBA1:c.99G>A | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37795 |
509 | CD 34 CTG>CGG [Leu>Arg] (Hb Ogi) | Hb Queens | HBA1:c.104T>G | α1 | Causative | α-chain variant | NG_000006.1 | 37800 |
2968 | CD 36 TTC>TAC [ Phe>Tyr] | Hb Kempten | HBA1:c.110T>A | α1 | Causative | α-chain variant | NG_000006.1 | 37806 |
370 | CD 37 -CCC [-Pro) | Hb Heraklion | HBA1:c.112_114delCCC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37808 |
517 | CD 38 ACC>ATC [Thr>Ile] | Hb Chelsea | HBA1:c.116C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37812 |
371 | CD 39 (-ACC) [-Thr] | Hb Taybe | HBA1:c.118_120del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37814 |
522 | CD 40 AAG>ACG [Lys>Thr] | Hb Pisa | HBA1:c.122A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37818 |
523 | CD 40 AAG>AAC [Lys>Asn] | Hb Saratoga Springs | HBA1:c.123G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37819 |
2385 | CD 42 TAC>TCC [Tyr>Ser] | Hb Erzeroum | HBA1:c.128A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37824 |
3557 | CD 43 TTC>CTC [Phe>Leu] | Hb Vanvitelli | HBA1:c.130T>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37826 |
530 | CD 44 CCG>GCG [Pro>Ala] (Hb Milne) | Hb Hagerstown | HBA1:c.133C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37829 |
3264 | CD 44 CCG>TCG [Pro>Ser] | Hb Wiangpapao | HBA1:c.133C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37829 |
536 | CD 45 CAC>CGC [His>Arg] | Hb Fort de France | HBA1:c.137A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37833 |
542 | CD 47 GAC>AAC [Asp>Asn] | Hb Arya | HBA1:c.142G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37838 |
2500 | CD 47 GAC>CAC [Asp>His] (Hb L-Ferrara, Hb Michigan-I, Hb Michigan-II, Hb Sealy, Hb Sinai) | Hb Hasharon | HBA1:c.142G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37838 |
547 | CD 48 CTG>CCG [Leu>Pro] | Hb Reading | HBA1:c.146T>C | α1 | Causative | α-chain variant | NG_000006.1 | 37842 |
3040 | CD 48 CTG>CGG [Leu>Arg] | Hb Montgomery | HBA1:c.146T>G | α1 | Causative | α-chain variant | NG_000006.1 | 37842 |
3026 | CD 49 AGC>CGC [Ser>Arg] | Hb Puerta del Sol | HBA1:c.148A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37844 |
2993 | CD 49 AGC>AAC [Ser>Asn] | Hb Furuset | HBA1:c.149G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37845 |
2529 | CD 50 +GGAGCC | Hb Bakersfield | HBA1:c.151_152insGGAGCC | α1 | Causative | α-chain variant | NG_000006.1 | 37847 |
550 | CD 50 CAC>CTC [His>Leu] | Hb Dublin | NM_000558.5(HBA1):c.152A>T | α1 | Causative | α-chain variant | NG_000006.1 | 37848 |
2501 | CD 50 CAC>CAG [His>Gln] | Hb Frankfurt | HBA1:c.153C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37849 |
553 | CD 51 GGC>AGC [Gly>Ser] | Hb Riccarton | HBA1:c.154G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37850 |
2502 | CD 51 GGC>CGC [Gly>Arg] | Hb Russ | HBA1:c.154G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37850 |
556 | CD 52-59 (-24 bp) | Hb J-Biskra | HBA1:c.157_180del | α1 | Causative | α-chain variant | NG_000006.1 | 37853 |
3442 | CD 51-58 (+24 bp) | Hb Choisy | HBA1:c.157_180dupTCTGCCCAGGTTAAGGGCCACGGC | α1 | Causative | α-chain variant | NG_000006.1 | 37853 |
3560 | CD 52 TCT>TGT [Ser>Cys] | Hb Dongguan | HBA1:c.158C>G | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37854 |
559 | CD 54 CAG>GAG [Gln>Glu] (Hb J-Paris-II, Hb Uppsala) | Hb Mexico | HBA1:c.163C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37859 |
560 | CD 54 CAG>CGG [Gln>Arg] (Hb Hikoshima) | Hb Shimonoseki | HBA1:c.164A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37860 |
3626 | CD 54 CAG>CAT [Gln>His] | Hb Goole | HBA1:c.165G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37861 |
561 | CD 55 GTT>CTT [Val>Leu] (Hb Poland) | Hb Roubaix | HBA1:c.166G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37862 |
562 | CD 55 GTT>GCT [Val>Ala] (Hb Gerland 1) | Hb Gerland | HBA1:c.167T>C | α1 | Causative | α-chain variant | NG_000006.1 | 37863 |
566 | CD 56 AAG>ACG [Lys>Thr] | Hb Thailand | HBA1:c.170A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37866 |
567 | CD 56 AAG>AAT or AAC [Lys>Asn] | Hb Belliard | HBA1:c.171G>C | HBA1:c.171G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37867 |
568 | CD 57 GGC>CGC [Gly>Arg] | Hb L-Persian Gulf | HBA1:c.172G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37868 |
3075 | CD 56/57 (+24bp) (HBA1:p.Lys57_Gly58insSerHisGlySerAlaGlnValLys , Hb KSVGH) | Hb Kaohsiung Veterans General Hospital | HBA1:c.171_172insAGCCACGGCTCTGCCCAAGTTAGG | α1 | Causative | α-chain variant | NG_000006.1 | 37868 |
3962 | CD 57 GGC>TGC [Gly>Cys] | Hb Kirikiriroa | HBA1:c.172G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37868 |
3175 | CD 58 CAC>CTC [His>Leu] | Hb Kirklareli | HBA1:c.176A>T | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37872 |
573 | CD 59 GGC>AGC [Gly>Ser] | Hb Parma | HBA1:c.178G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37874 |
3280 | CD 59 GGC>CGC [Gly>Arg] | Hb Zurich-Albisrieden | HBA1:c.178G>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37874 |
378 | CD 59 GGC>GAC [Gly>Asp] | Hb Adana | HBA1:c.179G>A | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37875 |
3624 | CD 60 AAG>GAG [Lys>Glu] | Hb Liuzhou | HBA1:c.182A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37878 |
578 | CD 60 AAG>AAT | Hb Zambia | HBA1:c.183G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37879 |
380 | CD 61 (-AAG) | Hb Clinic | HBA1:c.184_186del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37880 |
2982 | CD 61 AAG>AGG [Lys>Arg] | Hb Derby | HBA1:c.185A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37881 |
582 | CD AAG>AAT [Lys>Asn] | Hb J-Buda | HBA1:c.186G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37882 |
381 | CD 62 (-GTG) [-Val] | Hb Aghia Sophia | HBA1:c.187_189del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37883 |
382 | CD 62 GTG>-TG | Hb Champaign | HBA1:c.187delG | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37883 |
3015 | CD 63 GCC>ACC [Ala>Thr] | Hb Greenville-NC | HBA1:c.190G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37886 |
585 | CD 63 GCC>GAC [Ala>Asp] (Hb J-Pontoise) | Hb Pontoise | NM_000558.5(HBA1):c.191C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37887 |
383 | CD 64-74 (-33 bp) | N/A | HBA1:c.193_225del33 | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37889 |
587 | CD 64 GAC>CAC [Asp>His] | Hb Q-India | HBA1:c.193G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37889 |
2528 | CD 64 GAC>AAC [Asp>Asn] (Hb Wädenswil, Hb Burgos) | Hb G-Waimanalo | HBA1:c.193G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37889 |
2455 | CD 64 GAC>GCC [Asp>Ala] | Hb Lucan | HBA1:c.194A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37890 |
3788 | CD 65 GCG>CCG [Ala>Pro] | Hb Maruchi | HBA1:c.196G>C | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37892 |
594 | CD 68 AAC>CAC [Asn>His] | Hb Jeddah | HBA1:c.205A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37901 |
597 | CD 68 +GCGCTGACCAAC [+Ala-Leu-Thr-Asn] | Hb Esch | HBA1:c.207_208insGCGCTGACCAAC | α1 | Causative | α-chain variant | NG_000006.1 | 37904 |
599 | CD 70 GTG>ATG [Val>Met] | Hb Haaksbergen | HBA1:c.211G>A | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37907 |
2358 | CD 71 GCG>GTG [Ala>Val] (Hb Ozieri) | Hb Allison Park | HBA1:c.215C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37911 |
3312 | CD 72 CAC>CAG [His>Gln] | Hb Madonie | HBA1:c.219C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37915 |
2996 | CD 73 GTG>ATG [Val>Met] | Hb Argenteuil | HBA1:c.220G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37916 |
607 | CD 74 GAC>CAC [Asp>His] (Hb Asabara, Hb G-Taichung, Hb Kurashiki-I, Hb Mahidol) | Hb Q-Thailand | HBA1:c.223G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37919 |
3759 | CD 74 GAC>AAC [Asp>Asn] | Hb G-Pest | HBA1:c.223G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37919 |
3848 | -α4.2-Q-Thailand | N/A | N/A | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37919 |
608 | CD 74 GAC>GTC [Asp>Val] | Hb Les Lilas | HBA1:c.224A>T | α1 | Causative | α-chain variant | NG_000006.1 | 37920 |
609 | CD 74 GAC>GGC [Asp>Gly] | Hb Chapel Hill | HBA1:c.224A>G | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37920 |
3875 | CD 74 GAC>GAG [Asp>Glu] | Hb Jishui | HBA1:c.225C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37921 |
2503 | CD 75 GAC>TAC [Asp>Tyr] | Hb Winnipeg | HBA1:c.226G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37922 |
3760 | CD 75 GAC>AAC [Asp>Asn] | Hb Matsue-Oki | HBA1:c.226G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37922 |
2485 | CD 77 CCC>TCC [Pro>Ser] | Hb Nile | HBA1:c.232C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37928 |
2504 | CD 77 CCC>CAC [Pro>His] | Hb Toulon | HBA1:c.233C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37929 |
625 | CD 78 AAC>CAC [Asn>His] | Hb Davenport | HBA1:c.235A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37931 |
2505 | CD 78 AAC>AAG [Asn>Lys] | Hb Stanleyville-II | HBA1:c.237C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37933 |
3897 | CD 78 AAC>AAA [Asn>Lys] | Hb Qinzhou | HBA1:c.237C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37933 |
4081 | CD 79 GCG>GTG [Ala>Val] | Hb Tangshan | HBA1:c.239C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37935 |
632 | CD 81 TCC>TGC [Ser>Cys] | Hb Nigeria | HBA1:c.245C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37941 |
633 | CD 82 GCC>ACC (Ala>Thr) | Hb Hagley Park | HBA1:c.247G>A | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37943 |
2281 | CD 83 CTG>CGG [Leu>Arg] | Hb Ahvaz | HBA2: c.251T>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37947 |
637 | CD 84 AGC>AGA [Ser>Arg] | Hb Etobicoke | HBA1:c.255C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37949 |
639 | CD 85 GAC>AAC [Asp>Asn] | Hb G-Norfolk | HBA1:c.256G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37952 |
641 | CD 85 GAC>CAC [Asp>His] | Hb Canuts | HBA1:c.256G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37952 |
2336 | CD 86 CTG>GTG [Leu>Val] | N/A | HBA1:c.259C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37955 |
4098 | CD 86 CTG>CCG [Leu>Pro] | Hb Thessaloniki | HBA1:c.260T>C | α1 | Causative | α-chain variant | NG_000006.1 | 37956 |
647 | CD 87 CAC>GAC [His>Asp] | Hb Bonn | HBA1:c.262C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37958 |
2506 | CD 87 CAC>TAC [His>Tyr] (Hb M-Kankakee , Hb M-Oldenburg , Hb M-Sendai) | Hb M-Iwate | HBA1:c.262C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37958 |
649 | CD 87 CAC>CCC [His>Pro] | Hb Grifton | HBA1:c.263A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37959 |
3879 | CD 87 CAC>CTC [His>Leu] | Hb Padma River | HBA1:c.263A>T | α1 | Causative | α-chain variant | NG_000006.1 | 37959 |
3434 | CD 87 CAC>CAG [His>Gln] | Hb Lansing-Ramathibodi | HBA1:c.264C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37960 |
658 | CD 89 CAC>CAG [His>Gln] | Hb Buffalo | HBA1:c.270C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37966 |
3630 | CD 90 AAG>CAG [Lys>Gln] | Hb Luocheng | HBA1:c.271A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37967 |
662 | CD 90 AAG>AGG [Lys>Arg] | Hb Clinico Madrid II | HBA1:c.272A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37968 |
663 | CD 90 AAG>ACG | Hb J-Rajappen | HBA1:c.272A>C | α1 | Causative | α-chain variant | NG_000006.1 | 37968 |
3756 | CD 90 AAG>AAC [Lys>Asn] | Hb J-Broussais | HBA1:c.273G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37969 |
3993 | CD 90 AAG>AAT [Lys>Asn] | Hb Guigang | HBA1:c.273G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37969 |
665 | CD 91 CTT>TTT [Leu>Phe] (Hb Grey Lynn) | Hb Vientiane | HBA1:c.274C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37970 |
668 | CD 92 CGG>CAG [Arg>Gln] | Hb J-Cape Town | HBA1:c.278G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37973 |
3852 | CD 93 GTG>ATG [Val>Met] | Hb Qingcheng | HBA1:c.280G>A | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37976 |
672 | CD 93 GTG>GCG [Val>Ala] | Hb Die | HBA1:c.281T>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37977 |
2507 | CD 94 GAC>AAC [Asp>Asn] | Hb Titusville | HBA1:c.283G>A | α1 | Causative | α-chain variant | NG_000006.1 | 37979 |
2539 | IVS II-3 (+21bp) | Hb SKMC | HBA1:c.283_300+3dup | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37979 |
677 | CD 94 GAC>GCC [Asp>Ala] | Hb Bassett | HBA1:c.284A>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37980 |
678 | CD 94 GAC>GGC [Asp>Gly] | Hb Çapa | HBA1:c.284A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37980 |
681 | CD 95 CCG>ACG [Pro>Thr] | Hb Godavari | NM_000558.3(HBA1):c.286C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37982 |
684 | CD 95 CCG>CGG [Pro>Arg] | Hb St. Luke's | HBA1:c.287C>G | α1 | Causative | α-chain variant | NG_000006.1 | 37983 |
685 | CD 95 CCG>CAG [Pro>Gln] | Hb Wichita | HBA1:c.287C>A | α1 | Causative | α-chain variant | NG_000006.1 | 37983 |
3718 | CD 95 CCG>CTG [Pro>Leu] | Hb Georgia | HBA1:c.287C>T | α1 | Causative | α-chain variant | NG_000006.1 | 37983 |
4093 | CD 95 (-C) | Hb Campania | HBA1:c.287delC | α1 | Causative | α-thalassaemia, α-chain variant | NG_000006.1 | 37983 |
2357 | CD 96 GTC>CTC [Val>Leu] | Hb Woodstock | HBA1:c.289G>C | α1 | Causative | α-chain variant | NG_000006.1 | 37985 |
3914 | CD 97 AAC>AGC [Asn>Ser] | Hb Northwood | HBA1:c.293A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37989 |
690 | CD 99 AAG>GAG [Lys>Glu] (Hb Turriff-I) | Hb Turriff | NM_000558.5(HBA1):c.298A>G | α1 | Causative | α-chain variant | NG_000006.1 | 37994 |
691 | CD 99 AAG>AAT [Lys>Asn] (Hb Harlow) | Hb Beziers | HBA1:c.300G>T | α1 | Causative | α-chain variant | NG_000006.1 | 37996 |
2303 | CD 100 CTC>TTC (Leu>Phe) | Hb Weesp | HBA1:c.301C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38146 |
2305 | CD 100 CTC>CCC [Leu>Pro] | Hb Corsica | HBA1:c.302T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38147 |
2985 | CD 102 AGC>CGC [Ser>Arg] | Hb Manitoba IV | HBA1:c.307A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38152 |
693 | CD 102 AGC>AGA [Ser>Arg] | Hb Manitoba II | HBA1:c.309C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38154 |
695 | CD 103 CAC>TAC [His>Tyr] | Hb Charolles | HBA1:c.310C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38155 |
2532 | CD 103 CAC>GAC [His>Asp] | Hb Illinois | HBA1:c.310C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38155 |
395 | CD 104 TGC>AGC [Cys>Ser] | Hb Oegstgeest | HBA1:c.313T>A | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38158 |
3956 | CD 104 TGC>TAC [Cys>Tyr] | Hb Sallanches | HBA1:c.314G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38159 |
2340 | CD 104 TGC>TGG [Cys>Trp] | Hb Donnington | HBA1:c.315C>G | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38160 |
701 | CD 106 CTG>CCG [Leu>Pro] | Hb Charlieu | HBA1:c.320T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38165 |
2315 | CD 110 GCC>GTC [Ala>Val] (Hb White Rose) | Hb Montluel | HBA1:c.332C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38177 |
708 | CD 112 CAC>GAC [His>Asp] | Hb Hopkins-II | NM_000558.5(HBA1):c.337C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38182 |
2377 | CD 112 CAC>CAA [His>Gln] | Hb West Allis | HBA1:c.339C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38184 |
2316 | CD 114 CCC>GCC [Pro>Ala] | Hb Broomhill | NM_000558.5(HBA1):c.343C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38188 |
715 | CD 114 CCC>CTC [Pro>Leu] | Hb Nouakchott | NM_000558.3(HBA1):c.344C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38189 |
3378 | CD 114 CCC>CAC [Pro>His] | Hb Hubei | HBA1:c.344C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38189 |
2322 | CD 115 GCC>GTC [Ala>Val] | Hb Palmela | HBA1:c.347C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38192 |
720 | CD 116 GAG>AAG [Glu>Lys] (Hb Buginese-X, Hb Oliviere) | Hb O-Indonesia | HBA1:c.349G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38194 |
723 | CD 118-119 +9 bp [+Glu-Phe-Thr] (Hb Dakar) | Hb Grady | HBA1:c.349_357dup | α1 | Causative | α-chain variant | NG_000006.1 | 38194 |
719 | CD 116 GAG>GCG [Glu>Ala] | Hb Ube-4 | HBA1:c.350A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38195 |
724 | CD 117/118 +ATC [+Ile] | Hb Phnom Penh | HBA1:c.354_355insATC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38199 |
3036 | CD 117/118 +TCA [+Ser] | Hb Wexham | HBA1:c.354_355insTCA | α1 | Causative | α-chain variant | NG_000006.1 | 38199 |
406 | CD 119 CCT>TCT [Pro>Ser] (Hb Bemalda P, Hb Bernalda) | Hb Groene Hart | HBA1:c.358C>T | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38203 |
726 | CD 119 CCT>CTT [Pro>Leu] | Hb Diamant | HBA1:c.359C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38204 |
2508 | CD 120 GCG>GAG [Ala>Glu] (Hb J-Birmingham) | Hb J-Meerut | HBA1:c.362C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38207 |
728 | CD 121 GTG>ATG [Val>Met] | Hb Owari | HBA1:c.364G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38209 |
729 | CD 122 CAC>TAC [His>Tyr] | Hb Yanase | HBA1:c.367C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38212 |
3751 | CD 122 CAC>GAC [His>Asp] | Hb Daxin | HBA1:c.367C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38212 |
407 | CD 123 GCC >CCC [Ala>Pro] | Hb Voreppe | HBA1:c.370G>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38215 |
733 | CD 123 GCC>TCC [Ala>Ser] | Hb Mulhacen | HBA1:c.370G>T | α1 | Causative | α-chain variant | NG_000006.1 | 38215 |
3016 | CD 123 GCC>GTC [Ala>Val] | Hb Louisa | HBA1:c.371C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38216 |
2984 | CD124 TCC>TGC [Ser>Cys] | Hb Harehills | HBA1:c.374C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38219 |
2414 | CD 125 CTG>CCG [Leu>Pro] | Hb Quong Sze II | HBA1:c.377T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38222 |
738 | CD 126 GAC>CAC [Asp>His] | Hb Sassari | HBA1:c.379G>C | α1 | Causative | α-chain variant | NG_000006.1 | 38224 |
739 | CD 126 GAC>TΑC [Asp>Tyr] | Hb Montefiore | HBA1:c.379G>T | α1, α1 or α2 | Causative | α-chain variant | NG_000006.1 | 38224 |
2408 | CD 126 GAC>GCC [Asp>Ala] | Hb Verdun | HBA1:c.380A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38225 |
743 | CD 126 GAC>GAG [Asp>Glu] | Hb Burlington | HBA1:c.381C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38226 |
3380 | CD 127 AAG>GAG [Lys>Glu] | Hb Shantou | HBA1:c.382A>G | α1 | Causative | α-chain variant | NG_000006.1 | 38227 |
3789 | CD 127 AAG>CAG [Lys>Gln] | Hb Waikato | HBA1:c.382A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38227 |
411 | CD 129 CTG>CCG [Leu>Pro] | Hb Tunis-Bizerte | NM_000558.3(HBA1):c.389T>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38234 |
749 | CD 130 GCT>GTT [Ala>Val] | Hb Westborough | HBA1:c.392C>T | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 38237 |
3281 | CD 130 (+T) | Hb Sichuan | HBA1:c.393_394insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38238 |
752 | CD 131 TCT>TTT | Hb Lusaka | HBA1:c.395C>T | α1 | Causative | α-chain variant | NG_000006.1 | 38240 |
416 | CD 131 (+T) >175aa | Hb Pak Num Po | HBA1:c.396dup | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38241 |
753 | CD 131 TCT>TC- | Hb Fez | HBA1:c.396delT | α1 | Causative | α-chain variant | NG_000006.1 | 38241 |
2323 | CD 132 GTG>ATG [Val>Met] | Hb Portimão | HBA1:c.397G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38242 |
3723 | CD 132 GTG>GCG [Val>Ala] | N/A | HBA1:c.398T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38243 |
4027 | CD 133 AGC>CGC [Ser>Arg] | Hb Val de Marne | HBA2:c.400A>C | α2 | Causative | α-chain variant | NG_000006.1 | 38245 |
760 | CD 134 -C | Hb Senlis | HBA1:c.404delC | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 38249 |
762 | CD 135 GTG>CTG [Val>Met] | Hb Trenton | HBA1:c.406G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38251 |
763 | CD 135 GTG>ATG [Val>Glu] | Hb Pavie | HBA1:c.407T>A | HBA2:c.407T>A | α1 or α2 | Causative | α-chain variant | NG_000006.1 | 38252 |
3724 | CD 136 CTG>CAG [Leu>Gln] | N/A | HBA1:c.410T>A | α1 | Causative | α-chain variant | NG_000006.1 | 38255 |
767 | CD 137 ACC>CCC [Thr>Pro] | Hb Verona | HBA1:c.412A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38257 |
3802 | CD 138 TCC>GCC [Ser>Ala] | Hb Paynesville | HBA1:c.415T>G | α1 | Causative | α-chain variant | NG_000006.1 | 38260 |
769 | CD 138 TCC>TGC [Ser>Cys] | Hb Ecuador | HBA1:c.416C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38261 |
771 | CD 139 AAA>GAA [Ala>Glu] | Hb Hanamaki-1 | HBA1:c.418A>G | α1 | Causative | α-chain variant | NG_000006.1 | 38263 |
4017 | CD 139 AAA>TAA [Lys>STOP] (Tenerife) | Hb Nivaria | HBA1:c.418A>T | α1 | Causative | α-chain variant | NG_000006.1 | 38263 |
773 | CD 139 AAA>ACA [Lys>Thr] | Hb Tokoname | NM_000558.5(HBA1):c.419A>C | α1 | Causative | α-chain variant | NG_000006.1 | 38264 |
776 | CD 140 TAC>CAC [Tyr>His] | Hb Ethiopia | NM_000558.5(HBA1):c.421T>C | α1 | Causative | α-chain variant | NG_000006.1 | 38266 |
3972 | CD 140 TAC>TAA [Tyr>STOP] | Hb Natal | HBA1:c.423C>A | α1 | Causative | α-chain variant | NG_000006.1 | 38268 |
779 | CD 141 CGT>GGT [Arg>Gly] | Hb J-Camagüey | NM_000558.3(HBA1):c.424C>G | α1 | Causative | α-chain variant | NG_000006.1 | 38269 |
782 | CD 141 CGT>CTT [Arg>Leu] | Hb Legnano | HBA1:c.425G>T | α1 | Causative | α-chain variant | NG_000006.1 | 38270 |
783 | CD 141 CGT>CAT [Arg>His] | Hb Suresnes | NM_000558.3(HBA1):c.425G>A | α1 | Causative | α-chain variant | NG_000006.1 | 38270 |
3890 | CD 18 GGC>TGC [Gly>Cys] | Hb Jiujiang | HBA2:c.55G>T | α2 | Causative | α-chain variant | NG_000006.1 | 172967 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-10-23 15:23:06