IthaID: 2526

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 142 TAA>TTA >172aa HGVS Name: HBA2:c.428A>T
Hb Name: Hb Kinshasa Protein Info: α2 142, Stop>Leu; modified C-terminal sequence: (142)Leu-Ala-Gly-Ala-Ser-Val-Ala-Val-Pro-Pro-Ala-Arg-Trp-Ala-Ser-Gln-Arg-Ala-Leu-Leu-Pro-Ser-Leu-His-Arg-Pro-Phe-Leu-Val-Phe-(172)Glu-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ACCGTGCTGACCTCCAAATACCGTT [A/T] AGCTGGAGCCTCGGTAGCCGTTCCT (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: Hyperunstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34462
Size: 1 bp
Located at: α2
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Congolese
Molecular mechanism: Elongated globin
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Saller E, Dutly F, Frischknecht H, Two novel α2 gene mutations causing altered amino acid sequences produce a mild (Hb Kinshasa, HBA2: c.428A > T) and severe (HBA2: c.342-345insCC) α-thalassemia phenotype., Hemoglobin , 39(2), 144-6, 2015
Created on 2014-10-09 11:15:42, Last reviewed on 2016-09-09 09:39:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.