IthaID: 2641
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs16996672 | HGVS Name: | NG_011884.2:g.63094G>A |
Context nucleotide sequence:
GCCATATACATAGATCCACACAAGG [C/T] ACACAGCTGCACACGCATTCACAGA (Strand: +)
Also known as:
Comments: SNP associated with proteinuria in individuals with sickle cell disease (SCD) acquired from the Duke University Medical Center, the University of North Carolina at Chapel Hill, the East Carolina University and the Emory University Sickle Cell Centers (n=521). Also associated with focal segmental glomerulosclerosis (FSGS) in African American individuals with SCD (56 cases; 1759 controls).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Proteinuria [HP:0000093] Focal segmental glomerulosclerosis [HP:0000097] |
Location
| Chromosome: | 22 |
|---|---|
| Locus: | NG_011884.2 |
| Locus Location: | 63094 |
| Size: | 1 bp |
| Located at: | MYH9 |
| Specific Location: | Intron 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Genovese G, Tonna SJ, Knob AU, Appel GB, Katz A, Bernhardy AJ, Needham AW, Lazarus R, Pollak MR, A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9., Kidney Int. , 78(7), 698-704, 2010 PubMed
- Ashley-Koch AE, Okocha EC, Garrett ME, Soldano K, De Castro LM, Jonassaint JC, Orringer EP, Eckman JR, Telen MJ, MYH9 and APOL1 are both associated with sickle cell disease nephropathy., Br. J. Haematol. , 155(3), 386-94, 2011 PubMed
Created on 2016-05-10 16:16:30,
Last reviewed on (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2016-05-10 16:16:30 | The IthaGenes Curation Team | Created |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45