IthaID: 2650



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2070744 HGVS Name: NG_011992.1:g.6933C>T

Context nucleotide sequence:
CCAGGGCATCAAGCTCTTCCCTGGC [C/T] GGCTGACCCTGCCTCAGCCCTAGTC (Strand: +)

Also known as: -786T>C, T786C

Comments: The eNOS −786T>C polymorphism is associated with reduced endothelial nitric oxide synthesis. The C-786 allele associated with an upregulation of the adhesion molecule VCAM-1, as well as with upper respiratory tract infection in patients with sickle cell disease (SCD) from Northeast Brazil [PMID: 27486304]. It associated with increased susceptibility to acute chest syndrome (ACS) in African-American females with SCD (16-71 years old) [PMID: 14687036]. This association was not replicated in an independent African-American SCD cohort comprised mainly of pediatric patients [PMID: 17351927], while it associated with a decreased risk of ACS in pediatric SCD patients from Guadeloupe [PMID: 16956834]. It associated with occurence of ACS in Egyptian SCD patients [PMID: 26903375]. SNP associated with age onset of menarche in females with SCD from India [PMID: 23795274]. SNP (T allele) associated with lower bilirubin levels in a Portuguese cohort of SCD patients of Sub-Saharan ancestry [PMID: 24168396]. SNP (C allele) associated with retinopathy in Greek patients with severe clinical course of SCD [PMID: 27871907]. SNP (TT genotype) associated with an increased reticulocyte count and high serum lactate dehydrogenase levels in pediatric SCA patients from Portugal [PMID: 27802215].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Location

Chromosome: 7
Locus: NG_011992.1
Locus Location: 6933
Size: 1 bp
Located at: NOS3
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African American, Guadeloupean, Indian, Brazilian, Egyptian, Sub-Saharan African, Greek, Portuguese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Sharan K, Surrey S, Ballas S, Borowski M, Devoto M, Wang KF, Sandler E, Keller M, Association of T-786C eNOS gene polymorphism with increased susceptibility to acute chest syndrome in females with sickle cell disease., Br. J. Haematol. , 124(2), 240-3, 2004 PubMed
  2. Chaar V, Tarer V, Etienne-Julan M, Diara JP, Elion J, Romana M, ET-1 and ecNOS gene polymorphisms andsusceptibility to acute chest syndrome and painful vaso-occlusive crises in children with sickle cell anemia., Haematologica , 91(9), 1277-8, 2006 PubMed
  3. Duckworth L, Hsu L, Feng H, Wang J, Sylvester JE, Kissoon N, Sandler E, Lima JJ, Physician-diagnosed asthma and acute chest syndrome: associations with NOS polymorphisms., Pediatr. Pulmonol. , 42(4), 332-8, 2007 PubMed
  4. Nishank SS, Endothelial Nitric Oxide Synthase (eNOS) Gene Polymorphism is Associated with Age Onset of Menarche in Sickle Cell Disease Females of India., Mediterr J Hematol Infect Dis , 5(1), e2013036, 2013 PubMed
  5. Coelho A, Dias A, Morais A, Nunes B, Ferreira E, Picanço I, Faustino P, Lavinha J, Genetic variation in CD36, HBA, NOS3 and VCAM1 is associated with chronic haemolysis level in sickle cell anaemia: a longitudinal study., Eur. J. Haematol. , 92(3), 237-43, 2014 PubMed
  6. Vilas-Boas W, Figueiredo CV, Pitanga TN, Carvalho MO, Santiago RP, Santana SS, Guarda CC, Zanette AM, Cerqueira BA, Gonçalves MS, Endothelial Nitric Oxide Synthase (-786T>C) and Endothelin-1 (5665G>T) Gene Polymorphisms as Vascular Dysfunction Risk Factors in Sickle Cell Anemia., Gene Regul Syst Bio , 10(0), 67-72, 2016 PubMed
  7. Yousry SM, Ellithy HN, Shahin GH, Endothelial nitric oxide synthase gene polymorphisms and the risk of vasculopathy in sickle cell disease., Hematology , 21(6), 359-67, 2016 PubMed
  8. Aguiar L, Matos A, Gil Â, Afonso C, Braga L, João L, Kjollerstrom P, Faustino P, Bicho M, Inácio Â, Sickle cell anemia - Nitric oxide related genetic modifiers of hematological and biochemical parameters., Clin. Hemorheol. Microcirc. , 2016 PubMed
  9. Armenis I, Kalotychou V, Tzanetea R, Kollia P, Kontogeorgiou Z, Anastasopoulou D, Mantzourani M, Samarkos M, Pantos K, Konstantopoulos K, Rombos I, Prognostic value of T786C and G894T eNOS polymorphisms in sickle cell disease., Nitric Oxide , 62(0), 17-23, 2017 PubMed
Created on 2016-05-10 18:14:25, Last reviewed on 2019-07-03 15:58:01 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.