IthaID: 2659
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs1042714 | HGVS Name: | NG_016421.1:g.5318C>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TGCGCCGGACCACGACGTCACGCAG [C/G/T] AAAGGGACGAGGTGTGGGTGGTGGG (Strand: +)
Comments: SNP associated with protection from stroke (large vessel subtype) in pediatric sickle cell disease (SCD) patients acquired from the Cooperative Study of Sickle Cell Disease (CSSCD) (n=230) [PMID: 14615367]. The association was not replicated in two independent studies, which enrolled pediatric SCD patients from the Stroke Prevention Trial in Sickle Cell Anemia (STOP) (45 cases; 45 controls) [PMID: 17600229] and the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823], respectively.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
Chromosome: | 5 |
---|---|
Locus: | NG_016421.1 |
Locus Location: | 5318 |
Size: | 1 bp |
Located at: | ADRB2 |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Hoppe C, Klitz W, Cheng S, Apple R, Steiner L, Robles L, Girard T, Vichinsky E, Styles L, , Gene interactions and stroke risk in children with sickle cell anemia., Blood , 103(6), 2391-6, 2004 PubMed
- Hoppe C, Klitz W, D'Harlingue K, Cheng S, Grow M, Steiner L, Noble J, Adams R, Styles L, , Confirmation of an association between the TNF(-308) promoter polymorphism and stroke risk in children with sickle cell anemia., Stroke , 38(8), 2241-6, 2007 PubMed
- Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011 PubMed