IthaID: 2679



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs17728960 HGVS Name: NC_000020.11:g.51513177T>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
AAGTTTTTAAATCATATATTGGATC [C/T] TCAAAGTTACAGGCACTTGGGCCAC (Strand: +)

Comments: SNP associated with acute chest syndrome in the Cooperative Study of Sickle Cell Disease (CSSCD) (n=1901). Follow-up validation studies replicated the association in individuals with sickle cell disease (SCD) acquired from the Georgia Health Sciences University (GHSU) Sickle Cell Center (n=318) but not in an independent SCD cohort acquired from the Duke University (n=449).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Acute chest syndrome

Location

Chromosome: 20
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: NFATC2
Specific Location: Intron 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Galarneau G, Coady S, Garrett ME, Jeffries N, Puggal M, Paltoo D, Soldano K, Guasch A, Ashley-Koch AE, Telen MJ, Kutlar A, Lettre G, Papanicolaou GJ, Gene-centric association study of acute chest syndrome and painful crisis in sickle cell disease patients., Blood , 122(3), 434-42, 2013 PubMed
Created on 2016-05-11 17:16:32, Last reviewed on 2016-05-11 17:23:08 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.