IthaID: 2688

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs7300155	HGVS Name:	NG_042166.1:g.25282C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TAGTCAGGCTAGCTCCCTTCCCCCA [A/G] TCCCTGCCCCACCATACACAGAACA (Strand: +)

Comments: SNP (GG genotype) associated with elevated red blood cell adhesion to laminin in individuals with sickle cell disease (SCD) acquired from the Sickle cell Centre of the Duke University. Red cell adhesion is thought to contribute to the vaso-occlusive process in SCD.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	RBC adhesion

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	12
Locus:	NG_042166.1
Locus Location:	25282
Size:	1 bp
Located at:	ADCY6
Specific Location:	Intron 20

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	N/A
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Eyler CE, Jackson T, Elliott LE, De Castro LM, Jonassaint J, Ashley-Koch A, Telen MJ, beta(2)-Adrenergic receptor and adenylate cyclase gene polymorphisms affect sickle red cell adhesion., Br. J. Haematol. , 141(1), 105-8, 2008 PubMed

Created on 2016-05-12 10:01:13, Last reviewed on 2019-07-02 22:22:59 (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-05-12 10:01:13	The IthaGenes Curation Team	Created
2	2016-05-25 17:06:23	The IthaGenes Curation Team	Reviewed.
3	2017-10-16 17:28:04	The IthaGenes Curation Team	Reviewed. Mutation comment and Clinical phenotype reviewed.
4	2019-07-02 22:22:59	The IthaGenes Curation Team	Reviewed. Clinical phenotype corrected.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.