IthaID: 2718

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7130110 HGVS Name: NG_000007.3:g.22742C>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCAGTTATGCCACACTTTCCTACAT [C/G] ATGGGCACTGAAGGTTAAAACTTGA (Strand: +)

Comments: SNP associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD) (≥24 years, n=538; <24 years, n=980). Associated with the HbF response to hydroxyurea in pediatric patients with sickle cell disease.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Hb F response to hydroxyurea

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 22742
Size: 1 bp
Located at: ε
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American, Hispanic
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008
  2. Ware RE, Despotovic JM, Mortier NA, Flanagan JM, He J, Smeltzer MP, Kimble AC, Aygun B, Wu S, Howard T, Sparreboom A, Pharmacokinetics, pharmacodynamics, and pharmacogenetics of hydroxyurea treatment for children with sickle cell anemia., Blood , 118(18), 4985-91, 2011
  3. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013
Created on 2016-05-13 09:47:57, Last reviewed on 2016-05-25 11:27:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.