IthaID: 2769
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs736839 | HGVS Name: | NC_000018.10:g.49001695C>T |
Context nucleotide sequence:
CCCGTGTCCACACCCAGCACACTCC [C/T] GGCTTCAAATGCCCCAAAGGTCACA (Strand: +)
Also known as:
Comments: SNP associated with leg ulcers in the Cooperative Study of Sickle Cell Disease (CSSCD) (243 cases; 516 controls). Associated with acute chest syndrome in individuals with sickle cell disease.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Acute chest syndrome Leg ulcers [OMIM:150590] |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Nolan VG, Adewoye A, Baldwin C, Wang L, Ma Q, Wyszynski DF, Farrell JJ, Sebastiani P, Farrer LA, Steinberg MH, Sickle cell leg ulcers: associations with haemolysis and SNPs in Klotho, TEK and genes of the TGF-beta/BMP pathway., Br. J. Haematol. , 133(5), 570-8, 2006 PubMed
- Fertrin KY, Costa FF, Genomic polymorphisms in sickle cell disease: implications for clinical diversity and treatment., Expert Rev Hematol , 3(4), 443-58, 2010 PubMed
Created on 2016-05-16 11:00:35,
Last reviewed on 2016-05-23 16:02:06 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2016-05-16 11:00:35 | The IthaGenes Curation Team | Created |
| 2 | 2016-05-23 16:02:06 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45