IthaID: 2811

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2105819 HGVS Name: NG_000007.3:g.59119C>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
ATAATATGAAAACACAGAATTCAAA [C/G] AGCAGTGAACTGAGATTAGAATTGT (Strand: -)

Comments: Associated with HbF levels and disease severity in patients from Thailand with HbE/β0-thalassemia. Associated with HbF levels in the general (non-anaemic) population of Sardinia (n=4305).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Severity [HP:0012824]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 59119
Size: 1 bp
Located at: HBD-HBBP1
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai, Sardinian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Uda M, Galanello R, Sanna S, Lettre G, Sankaran VG, Chen W, Usala G, Busonero F, Maschio A, Albai G, Piras MG, Sestu N, Lai S, Dei M, Mulas A, Crisponi L, Naitza S, Asunis I, Deiana M, Nagaraja R, Perseu L, Satta S, Cipollina MD, Sollaino C, Moi P, Hirschhorn JN, Orkin SH, Abecasis GR, Schlessinger D, Cao A, Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia., Proc. Natl. Acad. Sci. U.S.A. , 105(5), 1620-5, 2008
  2. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
Created on 2016-05-17 09:48:31, Last reviewed on 2021-07-09 14:08:35 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.