
IthaID: 2815
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2071348 | HGVS Name: | NG_000007.3:g.54700A>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAAATTTGGTAGAGCAAGGACTATG [A/C] ATAATGGAAGGCCACTTACCATTTG (Strand: -)
Comments: Associated with disease severity and HbF levels in Thai and Indonesian β0-thalassaemia/HbE patients. Associated with higher Hb F levels and a milder β-thal disease phenotype in β-thal patients (major and/or intermedia) of Greek origin.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Severity [HP:0012824] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 54700 |
Size: | 1 bp |
Located at: | pseudo β |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Thai, Indonesian, Greek |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Ma Q, Abel K, Sripichai O, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Fucharoen S, Braun A, Farrer LA, Beta-globin gene cluster polymorphisms are strongly associated with severity of HbE/beta(0)-thalassemia., Clin. Genet. , 72(6), 497-505, 2007
- Nuinoon M, Makarasara W, Mushiroda T, Setianingsih I, Wahidiyat PA, Sripichai O, Kumasaka N, Takahashi A, Svasti S, Munkongdee T, Mahasirimongkol S, Peerapittayamongkol C, Viprakasit V, Kamatani N, Winichagoon P, Kubo M, Nakamura Y, Fucharoen S, A genome-wide association identified the common genetic variants influence disease severity in beta0-thalassemia/hemoglobin E., Hum. Genet. , 127(3), 303-14, 2010
- Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
- Giannopoulou E, Bartsakoulia M, Tafrali C, Kourakli A, Poulas K, Stavrou EF, Papachatzopoulou A, Georgitsi M, Patrinos GP, A single nucleotide polymorphism in the HBBP1 gene in the human β-globin locus is associated with a mild β-thalassemia disease phenotype., Hemoglobin , 36(5), 433-45, 2012
Created on 2016-05-17 10:53:22,
Last reviewed on 2021-07-08 15:56:33 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.