IthaID: 2818
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs6738440 | HGVS Name: | NG_011968.1:g.63393T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CACGGCATGGCATACAAATTATTTC [A/G] TTCCCATTGAGAAATAAAATCCAAT (Strand: +)
Comments: Associated with elevated HbF in African Americans with sickle cell disease, recruited from the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study, and the Thomas Jefferson University (n=244). The association was replicated in an independent patient sample acquired from the CSSCD study (243 cases; 247 controls). Associated with varying levels of HbF in sickle cell anaemia patients of Saudi Arab (from Eastern Province) origin. Associated with F-cell levels in the SIT Trial cohort.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_011968.1 |
| Locus Location: | 63393 |
| Size: | 1 bp |
| Located at: | BCL11A |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American, Saudi Arab |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
- Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015 PubMed
- Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed