IthaID: 2818



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs6738440 HGVS Name: NG_011968.1:g.63393T>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACGGCATGGCATACAAATTATTTC [A/G] TTCCCATTGAGAAATAAAATCCAAT (Strand: +)

Comments: Associated with elevated HbF in African Americans with sickle cell disease, recruited from the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study, and the Thomas Jefferson University (n=244). The association was replicated in an independent patient sample acquired from the CSSCD study (243 cases; 247 controls). Associated with varying levels of HbF in sickle cell anaemia patients of Saudi Arab (from Eastern Province) origin. Associated with F-cell levels in the SIT Trial cohort.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 63393
Size: 1 bp
Located at: BCL11A
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American, Saudi Arab
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011 PubMed
  2. Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015 PubMed
  3. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
Created on 2016-05-17 11:06:04, Last reviewed on 2020-10-05 14:40:39 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.