
IthaID: 2840
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs66650371 | HGVS Name: | NC_000006.12:g.135097495_135097497delTAC |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TAAATTCACTCTGGACAGCAGATGT [-/TAC] TATATCAAAACCACAAAATGTTATC (Strand: +)
Comments: rs66650371 is a 3-bp (TAC) deletion polymorphism located within an enhancer-like element 84 kb upstream of the MYB transcriptional start site (-84 LDB1 complex/KLF1-binding site). The rs66650371-deleted -84 allele negatively affects enhancer function and MYB regulation [PMID: 24614105]. Investigating a 50-bp RNA transcript adjacent to this variant, gave rise to a novel 1283 bp lncRNA with an important role in silencing γ-globin gene expression in adults [PMID: 29227829]. The 3-bp deleted allele of rs66650371 had a significant effect on the red blood cell, white blood cell and platelet counts, and strongly associated with elevated HbF and Hb levels in sickle cell disease cohorts from Tanzania [PMID: 25928412, 25263325] and Nigeria [PMID: 29879141]. It also associated with elevated HbF levels in β-thalassaemia patients and/or carriers from China and Hong Kong [PMID: 27835778, 21385855]. The association with HbF levels or F-cell numbers was not replicated in adult SCD patients from Dar es Salaam, Tanzania [PMID: 33073380]. Associated with HbF in Kuwaiti patients with SCD, where the homozygous carrier of the 3-bp deletion strongly associated with high HbF levels. Found in almost complete LD with rs9399137 and rs35786788, conveying a strong association with the highest level of HbF [PMID: 34204365].
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Abnormal platelet count [HP:0011873] Abnormal white blood cell count [HP:0011893] Abnormal red blood cell count [HP:0020058] Anaemia [HP:0001903] |
Location
Chromosome: | 6 |
---|---|
Locus: | NT_025741.15 |
Locus Location: | N/A |
Size: | 3 bp |
Located at: | HBS1L-MYB |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Tanzanian, Chinese, Nigerian, Kuwaiti |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Farrell JJ, Sherva RM, Chen ZY, Luo HY, Chu BF, Ha SY, Li CK, Lee AC, Li RC, Li CK, Yuen HL, So JC, Ma ES, Chan LC, Chan V, Sebastiani P, Farrer LA, Baldwin CT, Steinberg MH, Chui DH, A 3-bp deletion in the HBS1L-MYB intergenic region on chromosome 6q23 is associated with HbF expression., Blood , 117(18), 4935-45, 2011
- Stadhouders R, Aktuna S, Thongjuea S, Aghajanirefah A, Pourfarzad F, van Ijcken W, Lenhard B, Rooks H, Best S, Menzel S, Grosveld F, Thein SL, Soler E, HBS1L-MYB intergenic variants modulate fetal hemoglobin via long-range MYB enhancers., J. Clin. Invest. , 124(4), 1699-710, 2014
- Mtatiro SN, Mgaya J, Singh T, Mariki H, Rooks H, Soka D, Mmbando B, Thein SL, Barrett JC, Makani J, Cox SE, Menzel S, Genetic association of fetal-hemoglobin levels in individuals with sickle cell disease in Tanzania maps to conserved regulatory elements within the MYB core enhancer., BMC Med. Genet. , 16(0), 4, 2015
- Mtatiro SN, Makani J, Mmbando B, Thein SL, Menzel S, Cox SE, Genetic variants at HbF-modifier loci moderate anemia and leukocytosis in sickle cell disease in Tanzania., Am. J. Hematol., 90(1), E1-4, 2015
- Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016
- Adeyemo TA, Ojewunmi OO, Oyetunji IA, Rooks H, Rees DC, Akinsulie AO, Akanmu AS, Thein SL, Menzel S, A survey of genetic fetal-haemoglobin modifiers in Nigerian patients with sickle cell anaemia., PLoS ONE , 13(6), e0197927, 2018
- Morrison TA, Wilcox I, Luo HY, Farrell JJ, Kurita R, Nakamura Y, Murphy GJ, Cui S, Steinberg MH, Chui DHK, A long noncoding RNA from the HBS1L-MYB intergenic region on chr6q23 regulates human fetal hemoglobin expression., Blood Cells Mol. Dis., 69(0), 1-9, 2018
- Urio F, Nkya S, Rooks H, Mgaya JA, Masamu U, Zozimus Sangeda R, Mmbando BP, Brumat M, Mselle T, Menzel S, Luzzatto L, Makani J, F cell numbers are associated with an X-linked genetic polymorphism and correlate with haematological parameters in patients with sickle cell disease., Br J Haematol, 2020
- Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021