IthaID: 2889



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2076192 HGVS Name: NC_000006.12:g.136377559C>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGAGAGGCTTCATCAGCCTGCCTGG [A/C] GTCTGGTGTCCAGATAAGATGCTAA (Strand: +)

Comments: SNP associated with HbF level variation in the Multicenter Study of Hydroxyurea in SCA (n=280).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 6
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: MAP7
Specific Location: Intron 7

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Wyszynski DF, Baldwin CT, Cleves MA, Amirault Y, Nolan VG, Farrell JJ, Bisbee A, Kutlar A, Farrer LA, Steinberg MH, Polymorphisms near a chromosome 6q QTL area are associated with modulation of fetal hemoglobin levels in sickle cell anemia., Cell. Mol. Biol. (Noisy-le-grand) , 50(1), 23-33, 2004 PubMed
  2. Driss A, Asare KO, Hibbert JM, Gee BE, Adamkiewicz TV, Stiles JK, Sickle Cell Disease in the Post Genomic Era: A Monogenic Disease with a Polygenic Phenotype., Genomics Insights , 2009(2), 23-48, 2009 PubMed
Created on 2016-05-23 09:15:38, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.