IthaID: 2917



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2310991 HGVS Name: NC_000010.11:g.70171890C>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GTGCACATGCACAAACACACACACA [C>A] AAAAAACACAATGGAACAGAGCAAA (Strand: +)

Comments: SNP is located within 2KB 5' of SAR1A gene. SNP is associated with a significant change in HbF levels after 2 years of hydroxyurea (HU) treatment in African Americans with sickle cell disease (SCD) acquired from the Sickle Cell Pulmonary Hypertension Screening Study (n=32). SNP did not associate with baseline HbF or HU-induced HbF levels in SCD patients from Cameroon (n=484) and the U.S. (n=117).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F response to hydroxyurea

Location

Chromosome: 10
Locus: NM_001142648.2
Locus Location: N/A
Size: 1 bp
Located at: SAR1A
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Kumkhaek C, Taylor JG, Zhu J, Hoppe C, Kato GJ, Rodgers GP, Fetal haemoglobin response to hydroxycarbamide treatment and sar1a promoter polymorphisms in sickle cell anaemia., Br. J. Haematol. , 141(2), 254-9, 2008 PubMed
  2. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
  3. Pule GD, Bitoungui VJN, Chemegni BC, Kengne AP, Wonkam A, SAR1a promoter polymorphisms are not associated with fetal hemoglobin in patients with sickle cell disease from Cameroon., BMC Res Notes , 10(1), 183, 2017 PubMed
Created on 2016-05-24 18:11:15, Last reviewed on 2019-12-12 15:34:11 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.