IthaID: 2940
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs2280789 | HGVS Name: | NG_015990.1:g.5375T>C |
Context nucleotide sequence:
ATCTCCTGATCAGTTTTTCTGTCTT [C/T] AAGGTCTACACCCTCAAGGCCTACA (Strand: -)
Also known as: g.In1.+1T>C
Comments: The g.In1.1C variant associated with lower risk of bacterial infection recurrence in children with sickle cell disease (SCD) in Benin and in France (n=115) [PMID: 19425063]. The association was not replicated in an SCD cohort from Tunisia [PMID: 23900864].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | Decreased expression for CCL5 |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Recurrent infections [HP:0002719] |
Location
Chromosome: | 17 |
---|---|
Locus: | NG_015990.1 |
Locus Location: | 5375 |
Size: | 1 bp |
Located at: | CCL5 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Beninese, French |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Dossou-Yovo OP, Zaccaria I, Benkerrou M, Hauchecorne M, Alberti C, Rahimy MC, Elion J, Lapoumeroulie C, Effects of RANTES and MBL2 gene polymorphisms in sickle cell disease clinical outcomes: association of the g.In1.1T>C RANTES variant with protection against infections., Am. J. Hematol. , 84(6), 378-80, 2009 PubMed
- Kalai M, Chaouch L, Mansour IB, Hafsia R, Ghanem A, Abbes S, Frequency of three polymorphisms of the CCL5 gene (rs2107538, rs2280788 and rs2280789) and their implications for the phenotypic expression of sickle cell anemia in Tunisia., Pol J Pathol , 64(2), 84-9, 2013 PubMed
Created on 2016-08-09 11:07:12,
Last reviewed on 2019-07-03 22:19:50 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-08-09 11:07:12 | The IthaGenes Curation Team | Created |
2 | 2016-08-09 11:08:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2016-08-09 11:17:12 | The IthaGenes Curation Team | Reviewed. |
4 | 2016-08-09 11:27:14 | The IthaGenes Curation Team | Reviewed. |
5 | 2016-08-26 12:11:37 | The IthaGenes Curation Team | Reviewed. Location corrected. |
6 | 2019-07-03 22:19:50 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-24 11:43:02