IthaID: 2971



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: -44 C>A HGVS Name: HBA2:c.-81C>A

Context nucleotide sequence:
AATGAGCGCCGCCCGGCCGGGCGTG [C>A] CCCCGCGCCCCAAGCATAAAC (Strand: +)

Also known as:

Comments: Found as a heterozygote. Point-mutation located at the proximal promoter region affecting the α-inverted repeat protein (α-IRP) recognition site. α-IRP is a transcriptional activator. Functional studies did not show a statistically significant change in the transcriptional activity compared to the wild type. Reported as a polymoprhic variant.

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33695
Size: 1 bp
Located at: α2
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Qadah T, Finlayson J, Dennis M, Ghassemifar R, Molecular and cellular analysis of three novel alpha2-globin gene promoter mutations [HBA2: c.-59C>T], [HBA2: c.-81C>A] and [HBA2: c.-91G>A] reveal varying patterns of transcriptional and translational activities., Pathology , 46(1), 46-52, 2014 PubMed
Created on 2016-08-23 15:41:43, Last reviewed on 2017-07-31 12:18:46 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.