IthaID: 2988
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | -54 G>A | HGVS Name: | HBA2:c.-91G>A |
| Hb Name: | N/A | Protein Info: | α2 nt -54 G>A |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CGCGCCAGCCAATGAGCGCCGCCCG [G>A] CCGGGCGTGCCCCCGCGCCCCAAGC (Strand: +)
Comments: Found as a heterozygote with mild microcytosis. Point-mutation located at the proximal promoter region between two regulatory motifs recognised by the transcription factors Sp1 (Specificity Protein 1) and α-IRP (α-inverted repeat protein). Functional studies showed that it can cause up to 36% reduction in the transcriptional activity.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33685 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Qadah T, Finlayson J, Dennis M, Ghassemifar R, Molecular and cellular analysis of three novel alpha2-globin gene promoter mutations [HBA2: c.-59C>T], [HBA2: c.-81C>A] and [HBA2: c.-91G>A] reveal varying patterns of transcriptional and translational activities., Pathology , 46(1), 46-52, 2014
Created on 2016-08-23 17:11:10,
Last reviewed on 2017-07-31 12:12:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.