IthaID: 3092
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -148 G>A | HGVS Name: | NG_013087.1:g.4916G>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GATAAGGCAAAGCAAGGCAAGGCGG [C/T] GGGGGGGCACTGTTTCTGGGGCACA (Strand: +)
Comments: SNP found in an adult female of Serbian origin with high levels of HbF. The mutation was observed in normal Thai individuals with HbF <1% (n=100), but was absent in normal subjects of Greek origin (n=100). The mutation resides in the Sp1 binding site and alters Sp1 binding to KLF1 promoter, leading to a decreased gene transcription. It is considered to be extremely rare in the general population.
External Links
Phenotype
| Allele Phenotype (Cis): | Decreased expression for KLF1 |
|---|---|
| Allele Phenotype (Trans): | Increased expression for Aγ or Gγ |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 19 |
|---|---|
| Locus: | NG_013087.1 |
| Locus Location: | 4916 |
| Size: | 1 bp |
| Located at: | KLF1 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Serbian, Thai, Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Radmilovic M, Zukic B, Petrovic MS, Bartsakoulia M, Stankovic B, Kotur N, Dokmanovic L, Georgitsi M, Patrinos GP, Pavlovic S, Functional analysis of a novel KLF1 gene promoter variation associated with hereditary persistence of fetal hemoglobin., Ann. Hematol. , 92(1), 53-8, 2013 PubMed
- Tepakhan W, Yamsri S, Sanchaisuriya K, Fucharoen G, Xu X, Fucharoen S, Nine known and five novel mutations in the erythroid transcription factor KLF1 gene and phenotypic expression of fetal hemoglobin in hemoglobin E disorder., Blood Cells Mol. Dis. , 59(0), 85-91, 2016 PubMed
Created on 2016-09-13 11:02:07,
Last reviewed on 2016-09-14 09:46:20 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.