IthaID: 3095
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs5936 | HGVS Name: | NG_016323.1:g.9877G>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CAGAGGTGAGCTTCCTCAATTGCTC [G/T] CTGGACAACGGCGGCTGCACGCATT (Strand: +)
Protein sequence:
MWQLTSLLLFVATWGISGTPAPLDSVFSSSERAHQVLRIRKRANSFLEELRHSSLERECIEEICDFEEAKEIFQNVDDTLAFWSKHVDGDQCLVLPLEHPCASLCCGHGTCIDGIGSFSCDCRSGWEGRFCQREVSFLNCSLDNGGCTHYCLEEVGWRRCSCAPGYKLGDDLLQCHPAVKFPCGRPWKRMEKKRSHLKRDTEDQEDQVDPRLIDGKMTRRGDSPWQVVLLDSKKKLACGAVLIHPSWVLTAAHCMDESKKLLVRLGEYDLRRWEKWELDLDIKEVFVHPNYSKSTTDNDIALLHLAQPATLSQTIVPICLPDSGLAERELNQAGQETLVTGWGYHSSREKEAKRNRTFVLNFIKIPVVPHNECSEVMSNMVSENMLCAGILGDRQDACEGDSGGPMVASFHGTWFLVGLVSWGEGCGLLHNYGVYTKVSRYLDWIHGHIRDKEAPQKSWAP
Comments: SNP was found in a splenectomized patient with HbH disease and recurrent thromboembolism.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Thromboembolism [HP:0001907] |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_016323.1 |
| Locus Location: | 9877 |
| Size: | 1 bp |
| Located at: | PROC |
| Specific Location: | Exon 6 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Chinese Han |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Sun NA, Cheng P, Deng DH, Liu RR, Lai YR, Analysis of the genetic variants associated with recurrent thromboembolism in a patient with hemoglobin H disease following splenectomy: A case report., Biomed Rep , 5(1), 23-26, 2016 PubMed