IthaID: 3134



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs762551 HGVS Name: NG_008431.1:g.32035C>A

Context nucleotide sequence:
TGCTCAAAGGGTGAGCTCTGTGGGC [A/C] CAGGACGCATGGTAGATGGAGCTTA (Strand: +)

Also known as:

Comments: SNP associated with variability in deferasirox plasma levels in β-thalassaemia adult patients with transfusional iron overload. Patients with AA genotype had a lower drug concentration and thus a higher risk of non-response.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Response to deferasirox

Location

Chromosome: 15
Locus: NG_008431.2
Locus Location: 32035
Size: 1 bp
Located at: CYP1A2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Cusato J, Allegra S, Massano D, De Francia S, Piga A, D'Avolio A, Influence of single-nucleotide polymorphisms on deferasirox C trough levels and effectiveness., Pharmacogenomics J. , 15(3), 263-71, 2015 PubMed
Created on 2016-10-25 17:57:31, Last reviewed on 2016-10-26 09:24:47 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.