IthaID: 3139

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs60684937	HGVS Name:	NC_000017.11:g.69422989T>C

Context nucleotide sequence:
ATCGCCACCTCCTGGGTTCAAGCGA [C/T] CCTCCTGCCTCAGCCTCCCGAGTAG (Strand: +)

Also known as:

Comments: The T allele associated with increased plasma EPO levels in adult SCD patients from the Walk-PHaSST, PUSH, Howard and UIC cohorts. It also associated with increased expression of a non-coding transcript of PRKAR1A gene, suggesting that this SNP may contribute to EPO regulation through a cAMP-dependent protein kinase A pathway.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	EPO levels

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	17
Locus:	NG_029437.1
Locus Location:	N/A
Size:	1 bp
Located at:	MAP2K6
Specific Location:	Intron 1

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American, African
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Zhang X, Shah BN, Zhang W, Saraf SL, Miasnikova G, Sergueeva A, Ammosova T, Niu X, Nouraie M, Nekhai S, Castro O, Gladwin MT, Prchal JT, Garcia JG, Machado RF, Gordeuk VR, A genetic variation associated with plasma erythropoietin and a non-coding transcript of PRKAR1A in sickle cell disease., Hum. Mol. Genet. , 2016 PubMed

Created on 2017-01-16 13:27:39, Last reviewed on 2017-01-23 13:43:42 (Show full history)

A/A	Date	Curator(s)	Comments
1	2017-01-16 13:27:39	The IthaGenes Curation Team	Created
2	2017-01-23 13:43:42	The IthaGenes Curation Team	Reviewed. Clinical phenotype section updated.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.