IthaID: 3162

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1894397 HGVS Name: NG_000007.3:g.42859G>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACACTCGCTTCTGGAACGTCTGAG [A/G] TTATCAATAAGCTCCTAGTCCAGAC (Strand: -)

Comments: SNP associated with HbF levels in β-thalassaemia patients from Guangxi, Southern China (493 patients, 500 controls).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42859
Size: 1 bp
Located at:
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016
Created on 2017-01-31 10:35:56, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.