IthaID: 3212

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs61729510	HGVS Name:	NG_029826.1:g.21020G>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGAGCAGACTACTCCAACATCCCTG [C/T] TGTGGCTACAAGTTCCTTCTGGGCG (Strand: +)

Protein sequence:
MSKLRMVLLEDSGSADFRRHFVNLSPFTITVVLLLSACFVTSSLGGTDKELRLVDGENKCSGRVEVKVQEEWGTVCNNGWSMEAVSVICNQLGCPTAIKAPGWANSSAGSGRIWMDHVSCRGNESALWDCKHDGWGKHSNCTHQQDAGVTCSDGSNLEMRLTRGGNMCSGRIEIKFQGRWGTVCDDNFNIDHASVICRQLECGSAVSFSGSSNFGEGSGPIWFDDLICNGNESALWNCKHQGWGKHNCDHAEDAGVICSKGADLSLRLVDGVTECSGRLEVRFQGEWGTICDDGWDSYDAAVACKQLGCPTAVTAIGRVNASKGFGHIWLDSVSCQGHEPAIWQCKHHEWGKHYCNHNEDAGVTCSDGSDLELRLRGGGSRCAGTVEVEIQRLLGKVCDRGWGLKEADVVCRQLGCGSALKTSYQVYSKIQATNTWLFLSSCNGNETSLWDCKNWQWGGLTCDHYEEAKITCSAHREPRLVGGDIPCSGRVEVKHGDTWGSICDSDFSLEAASVLCRELQCGTVVSILGGAHFGEGNGQIWAEEFQCEGHESHLSLCPVAPRPEGTCSHNRDVGVVCSRYTEIRLVNGKTPCEGRVELKTLGAWGSLCNSHWDIEDAHVLCQQLKCGVALSTPGGARFGKGNGQIWRHMFHCTGTEQHMGDCPVTALGASLCPSEQVASVICSGNQSQTLSSCNSSSLGPTRPTIPEESAVACIESGQLRLVNGGGRCAGRVEIYHEGSWGTICDDSWDLSDAHVVCRQLGCGEAINATGSAHFGEGTGPIWLDEMKCNGKESRIWQCHSHGWGQQNCRHKEDAGVICSEFMSLRLTSEASREACAGRLEVFYNGAWGTVGKSSMSETTVGVVCRQLGCADKGKINPASLDKAMSIPMWVDNVQCPKGPDTLWQCPSSPWEKRLASPSEETWITCDNKIRLQEGPTSCSGRVEIWHGGSWGTVCDDSWDLDDAQVVCQQLGCGPALKAFKEAEFGQGTGPIWLNEVKCKGNESSLWDCPARRWGHSECGHKEDAAVNCTDISVQKTPQKATTGRSSRQSSFIAVGILGVVLLAIFVALFFLTKKRRQRQRLAVSSRGENLVHQIQYREMNSCLNADDLDLMNSSENSHESADFSAAELISVSKFLPISGMEKEAILSHTEKENGNL

Comments: SNP associated with increased glomerular filtration rate in SCA pediatric patients enrolled from the TWiTCH (TCD With Transfusions Changing to Hydroxyurea) trial.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Abnormal GFR [HP:0012212]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	12
Locus:	NG_029826.1
Locus Location:	21020
Size:	1 bp
Located at:	CD163
Specific Location:	Exon 7

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Missense codons (Protein Structure)
Ethnic Origin:	N/A
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Schaefer BA, Flanagan JM, Alvarez OA, Nelson SC, Aygun B, Nottage KA, George A, Roberts CW, Piccone CM, Howard TA, Davis BR, Ware RE, Genetic Modifiers of White Blood Cell Count, Albuminuria and Glomerular Filtration Rate in Children with Sickle Cell Anemia., PLoS ONE , 11(10), e0164364, 2016 PubMed

Created on 2017-03-21 14:57:16, Last reviewed on (Show full history)

A/A	Date	Curator(s)	Comments
1	2017-03-21 14:57:16	The IthaGenes Curation Team	Created

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.