IthaID: 3343
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs743811 | HGVS Name: | NC_000022.10:g.35792974T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTTACTAATAGGAGAATGGCTGAA [A/C/T] AATTTTTTCCTATCAATTGTCGAAC (Strand: +)
Comments: SNP associated with albuminuria, eGFR and chronic kidney disease stage in the University of Illinois SCD cohort (n=247), as well as with end-stage renal disease in the Walk-Treatment of Pulmonary Hypertension and Sickle cell Disease with Sildenafil Therapy cohort (n=540) [PMID: 26206798]. The 'C' allele associated with a decreased risk of albuminuria in a pediatric SCD cohort from Brazil [PMID: 32083326].
External Links
No available links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Abnormal GFR [HP:0012212] Albuminuria [HP:0012592] |
Location
| Chromosome: | 22 |
|---|---|
| Locus: | NG_023030.1 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | HMOX1 |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Saraf SL, Zhang X, Shah B, Kanias T, Gudehithlu KP, Kittles R, Machado RF, Arruda JA, Gladwin MT, Singh AK, Gordeuk VR, Genetic variants and cell-free hemoglobin processing in sickle cell nephropathy., Haematologica , 100(10), 1275-84, 2015 PubMed
- Belisário AR, de Almeida JA, Mendes FG, da Silva DMM, Planes W, Rezende PV, Silva CM, Brito AC, Sales RR, Viana MB, Simões E Silva AC, Prevalence and risk factors for albuminuria and glomerular hyperfiltration in a large cohort of children with sickle cell anemia., Am. J. Hematol., 95(5), E125-E128, 2020 PubMed
Created on 2018-08-23 19:31:04,
Last reviewed on 2020-06-26 13:34:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.