
IthaID: 3446
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | IVS II-579 G>T | HGVS Name: | HBB:c.316-272G>T |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
TTTCCCTAATCTCTTTCTTTCA [T/G] GGCAATAATGATACAATGTATCA (Strand: -)
Comments: This mutation is an innocuous SNP associated with a well-characterised cryptic splice acceptor site in HBB. The cryptic splice acceptor is activated by mutation IthaID 214, leading to aberrant splicing, inclusion of a pseudo-exon in the HBB mRNA and beta-thalassaemia. Mutation IthaID 214 retains residual normal splicing activity, and in presence of the causative mutation this SNP may thus conceivably increase normal splicing and ameliorate the associated phenotype.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71618 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Treisman R, Orkin SH, Maniatis T, Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes., Nature, 302(5909), 591-6, 1983
Created on 2019-09-23 12:50:17,
Last reviewed on 2020-09-28 16:57:24 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.