IthaID: 3465

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2445284 HGVS Name: NC_000011.10:g.5008473C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACACACAAACATTAGCTTACTCTTTCTTA [C>T] ACTATGAATTAATAACAAGATATTTTAAAA (Strand: +)

Comments: SNP associated with haemolysis in sickle cell anaemia in samples taken from the CSSCD (n=1117), Walk-PHaSST (n=449) and PUSH (n=296) studies.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 11
Locus:
Locus Location: N/A
Size: 1 bp
Located at: OR51L1-OR51P1P
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Milton JN, Rooks H, Drasar E, McCabe EL, Baldwin CT, Melista E, Gordeuk VR, Nouraie M, Kato GR, Kato GJ, Minniti C, Taylor J, Campbell A, Luchtman-Jones L, Rana S, Castro O, Zhang Y, Thein SL, Sebastiani P, Gladwin MT, , Steinberg MH, Genetic determinants of haemolysis in sickle cell anaemia., Br. J. Haematol. , 161(2), 270-8, 2013
Created on 2019-09-30 10:26:39, Last reviewed on 2019-12-13 10:10:06 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.