Loading... Please wait!
Quick filtering
Showing all entries with clinican phenotype Haemolytic anaemia (Show All):
Clinical Phenotypes:'Haemolytic anaemia'
Clinical Phenotypes:'Haemolytic anaemia'
| IthaID | Common Name | Hb Name | HGVS Name | Genes | Functionality | Phenotype | Locus | Position |
|---|---|---|---|---|---|---|---|---|
| 348 | -α3.7;CD 14 TGG>CGG | Hb Evanston | N/A | α1 or α2, α3.7 hybrid | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | |
| 400 | -α3.7;CD 109 CTG>CGG | Hb Suan Dok | N/A | α2, α3.7 hybrid | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | |
| 410 | -α3.7;CD 125 CTG>CAG [Leu>Gln] | N/A | N/A | α1 or α2, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 2244 | (αα)JM | N/A | NC_000016.10:48642_132584del | HS40, ζ, NPRL3 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 2248 | (αα)Sco | N/A | NC_000016.10:g.(93618_93635)_(141631_141648)del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 2252 | --BR | N/A | NC_000016.10:g.11555_229482del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 2268 | --BA | N/A | NC_000016.10:g.0_772369del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 3071 | --235 (--175) | N/A | NC_000016.10:g.10001_185264del | HS40, ζ, α2, α1, NPRL3 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 3292 | 15 kb deletion | N/A | NC_000016.10:g.172736_187935del | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 3296 | --GB | N/A | NC_000016.9:g.(161901_161910)_(178672_178681)del | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 3396 | IVS I-113 C>A | Hb Beach Haven | HBA2:c.96-5C>A | α3.7 hybrid | Causative | Haemolytic anaemia | NG_000006.1 | |
| 3407 | (αα)JS | N/A | NC_000016.10:g.46628_126325del | HS40, NPRL3 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | |
| 306 | -α7.9 | N/A | NG_000006.1:g.28322_36260del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 307 | -α18 (18 kb deletion) | N/A | N/A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 316 | -(α)5.2 | N/A | N/A | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 322 | --CI (28+ kb deletion.) | N/A | NC_000016.10:g.(158380_161516)_ (186053_?) | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 324 | --115 | N/A | NC_000016.10:g.(13158_13584)_(39907_41256)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 326 | --YEM | N/A | NG_000006.1:g.(16201_17547)_(41420_42633)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 329 | --KOL | N/A | NC_000016.10:g.(151719_151746)_(185067_185093)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 330 | --11.1 (11.1 kb deletion) | N/A | NG_000006.1:g.(31695_31724)_(42846_42867)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 331 | --OH | N/A | NC_000016.10:g.(149158_152418)_(249560_284571)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 332 | (αα)RA | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 333 | (αα)TI | N/A | NC_000016.10:g.10023_122854del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 334 | (αα)IJ | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 335 | (αα)CMO | N/A | NC_000016.10:g.10018_157684del | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 336 | (αα)TAT | N/A | NC_000016.10:g.10020_152823del | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 337 | (αα)MB | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 338 | (αα)IC | N/A | NC_000016.10:g.10018_131194delinsAC | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 339 | (αα)IdF | N/A | NC_000016.10:g.10020_154449del | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2233 | -ζ | N/A | N/A | ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2234 | -α16.6 | N/A | NG_000006.1:g.(19842_19845)_(36479_36486)delins22446_24085inv | ζ, α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2235 | α-αΔ970 (970 bp deletion) | N/A | NG_000006.1:g.36599_37568delinsTAG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2236 | --DUTCH I | N/A | NG_000006.1:g.7622_41156del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2237 | --AW | N/A | NG_000006.1:g.32143_40317delinsCTCCCTGGACAAGT | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2238 | --BGS | N/A | NC_000016.10:g.47749_179374del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2239 | --CAMPANIA | N/A | NC_000016.10:g.(8635_8924)_(39835_40133)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2240 | --FIL-2 (27.9 deletion) | N/A | NC_000016.10:g.156188_184103del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2241 | --ED | N/A | NC_000016.10:g.(110582_113386)_(187266_188773)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2242 | --GP | N/A | NC_000016.10:g.(43803_47123)_(187266_188649)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2243 | (αα)AS | N/A | N/A | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2245 | (αα)MM | N/A | NC_000016.10:g.(?_53322)_(141396_143702)del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2246 | (αα)L | N/A | NC_000016.10:g.(?_55799)_(152345_162796)del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2247 | (αα)SN | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2249 | (αα)ZW | N/A | NC_000016.10:g. 90778_106773del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2250 | (αα)RSR | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2251 | (αα)MCu | N/A | N/A | HS40, ζ | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2253 | --ZW | N/A | NC_000016.10:g.11555_229482del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2254 | --JY | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2255 | --LC | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2256 | --VR | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2257 | --JT | N/A | NC_000016.10:g.(44035_44092)_(312033_312090)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2258 | --AB | N/A | NC_000016.10:g.(?_55799)_(360870_410354)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2259 | --GZ | N/A | NC_000016.10:g.(?_53322)_(879639_910965)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2260 | Dutch II | N/A | NC_000016.10:g.(?_55799)_(284538_298092)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2261 | --MK | N/A | NC_000016.10:g.(113696_130566)_(298093_ 331093)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2262 | --80 | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2264 | --Brazil | N/A | NC_000016.10:g.(?_55799)_(986613_1063737)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2265 | --PV | N/A | NC_000016.10:g.(?_55799)_(1625950_1740473)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2266 | --HN | N/A | NC_000016.10:g.(?_55799)_(1923864_ 1939057)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2267 | --FT | N/A | NC_000016.10:g.(?_55799)_(1857769_1890275)del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2269 | --TN | N/A | NC_000016.10:g.0_976709del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2270 | --BO | N/A | NC_000016.10:g.0_1896761del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2271 | --IM | N/A | NC_000016.10:g.0_2021644del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2272 | --LIN | N/A | NC_000016.10:g.0_2023655del | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 2273 | --GS | N/A | N/A | HS40, ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3067 | --MEX1 | N/A | NG_000006.1:g.3(33114_33812)_(40649_42021)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3074 | (αα)JX | N/A | NC_000016.10:g.113161_113902del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3142 | -α6.3 | N/A | NG_000006.1:g.31022_37366del6344 | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3215 | --Braz | N/A | NC_000016.10:g.(167305_169853)_(239884_271794)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3244 | −KOZANI | N/A | NC_000016.10:g.(113686_143638)_(407521_?)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3284 | --PG | N/A | NC_000016.10:g.93628_542759del450131 | HS40, ζ, α2, α1, NPRL3, HBM, AXIN1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3293 | 97 kb deletion | N/A | NC_000016.10:g.56407_153678del | HS40 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3295 | 225 kb deletion | N/A | NC_000016.10:g.56407_281805del | HS40, ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3440 | -αMAL3.5 | N/A | NG_000006.1:g.32745_36301del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 3514 | 170 kb deletion | N/A | N/A | α2, α1, AXIN1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 0 |
| 327 | --MC | N/A | NC_000016.10:g.139301_182501del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 164 |
| 3214 | 44.6 kb deletion | N/A | NC_000016.10:g.144215_188841del | ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 5078 |
| 3408 | --60.2 | N/A | NC_000016.10:g.147589_207883del | ζ, α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8452 |
| 323 | --CAL | N/A | NG_000006.1:g.8464_40664del32201 | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8464 |
| 313 | --MED II | N/A | NG_000006.1:g.(7740_9712)_(39907_41156)del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 8726 |
| 310 | --THAI | N/A | NC_000016.10:g.149863_183312del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 10726 |
| 325 | --RT | N/A | NC_000016.10:g.151401_188301del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 12264 |
| 311 | --FIL | N/A | NC_000016.10:g.151641_182316del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 12504 |
| 321 | --CL | N/A | NC_000016.10:g.152451_263801del | ζ, α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 13314 |
| 320 | --BRIT | N/A | NC_000016.10:g.155501_184801del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 16364 |
| 314 | -(α)20.5 | N/A | NG_000006.1:g.(18148_18200)_(37868_37901)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 18200 |
| 319 | --MA | N/A | NG_000006.1:g.18964_39864del20901 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 18964 |
| 315 | --SA | N/A | NC_000016.10:g.159052_182788delins139752_139596 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 19464 |
| 3294 | 22 kb deletion | N/A | NG_000006.1:g.20350_42078del | α2, α1, HBM | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 20350 |
| 312 | --MED I | N/A | NG_000006.1:g.(23641_23662)_(41183_41203)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 23662 |
| 309 | --SEA | N/A | NC_000016.10:g.165401_184701del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 26264 |
| 305 | -α5.3 | N/A | NG_000006.1:g.28684_33930del5246 | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 28684 |
| 328 | --CANT | N/A | NC_000016.10:g.(168531_169756)_(182770_183028)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 29394 |
| 3603 | -α6.9 | N/A | NG_000006.1:g.29785_36746del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 29785 |
| 318 | --SPAN | N/A | NC_000016.10:g.(169756_170100)_(179044_181595)del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 30619 |
| 301 | -α4.2 | N/A | NC_000016.10:g.169818_174075del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 30681 |
| 3360 | 9.7 kb deletion | N/A | NG_000006.1:g.32709_42418del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 32709 |
| 317 | --GEO | N/A | NG_000006.1:g.32864_42264del9401 | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 32864 |
| 3994 | 10.3 kb deletion | N/A | NC_000016.10:g.172342_182690del | α2, α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33205 |
| 346 | -α3.7;Init CD ACCATG>--CATG | N/A | NG_000006.1:g.[33773_33774del;34247_38050del] | α2, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33773, 34247 |
| 344 | Init CD ATG>-TG | N/A | HBA2:c.1delA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33776 |
| 345 | -α3.7;Init CD ATG>GTG | N/A | NG_000006.1:g.[33776A>G;34247_38050del] | α2, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33776, 34247 |
| 342 | Init CD ATG>ACG [Met>Thr] | N/A | HBA2:c.2T>C | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
| 343 | Init CD ATG>A-G | N/A | HBA2:c.2delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
| 2460 | Init CD ATG>AGG [Met>Arg] | N/A | HBA2:c.2T>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33777 |
| 2206 | CD 8 (-C) | N/A | HBA2:c.27delC | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33802 |
| 2433 | CD 13-14 -GCCTGG [-Ala-Trp] | Hb Souli | HBA2:c.40_45delGCCTGG | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33815 |
| 350 | CD 18 GGC>G-C | N/A | HBA2:c.56delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33831 |
| 351 | CD 21 GCT>TCT [Ala>Ser] | Hb Zoetermeer | HBA2:c.64G>T | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33839 |
| 2207 | CD 21/22 +T | N/A | HBA2:c.66dupT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33841 |
| 352 | CD 22 GGC>GGT new donor consensus | N/A | HBA2:c.69C>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33844 |
| 353 | CD 22 -C | N/A | HBA2:c.69delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33844 |
| 354 | CD 23 GAG>TAG [Glu>STOP] | N/A | HBA2:c.70G>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33845 |
| 490 | CD 24 TAT>GAT [Tyr>Asp] | Hb Creve Coeur | HBA2:c.73T>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 33848 |
| 2208 | CD 24 TAT>TAG | N/A | HBA2:c.75T>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33850 |
| 2538 | CD 25 GGT>GAT [Gly>Asp] | Hb Cibeles | HBA2:c.77G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33852 |
| 355 | CD 26 GCG>ACG [Ala>Thr] | Hb Caserta | HBA2:c.79G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33854 |
| 494 | CD GCG>GAG [Ala>Glu] | Hb Shenyang | HBA2:c.80C>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 33855 |
| 495 | CD 27 GAG>AAG [Glu>Lys] | Hb Shuangfeng | HBA2:c.82G>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 33857 |
| 356 | CD 29 CTG>CCG [Leu>Pro] | Hb Agrinio | HBA2:c.89T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33864 |
| 357 | CD 30 -GAG [-Glu] | N/A | HBA2:c.91_93delGAG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33866 |
| 2210 | CD 31 AGG>CGG [Arg>Arg] | N/A | HBA2:c.94A>C | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33869 |
| 366 | CD 31 AGG>AAG [Arg>Lys] | N/A | HBA2:c.95G>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33870 |
| 359 | IVS I-1 (-5 bp) GAGGTGAGG>GAGG----- donor (α-5nt) | N/A | HBA2:c.95+2_95+6delTGAGG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33872 |
| 360 | IVS I-5 G>A | N/A | HBA2:c.95+5 G>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33875 |
| 362 | IVS I-55 G>A | N/A | HBA2:c.95+55 G>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33925 |
| 363 | IVS I-116 GCAGGA>GCGGGA acceptor | N/A | HBA2:c.96-2A>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 33986 |
| 2209 | CD 32 ATG>AGG [Met>Arg] (Hb Gran Vía) | Hb Rotterdam | HBA2:c.98T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33990 |
| 367 | CD 32 G>A | Hb Amsterdam | HBA2:c.99G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33991 |
| 368 | CD 33 T>C | Hb Chartres | HBA2:c.101T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33993 |
| 369 | CD 35 TCC>CCC [Ser>Pro] | Hb Evora | HBA2:c.106T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 33998 |
| 2211 | CD 37 CCC>CC- | N/A | HBA2:c.114delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34006 |
| 372 | CD 39-41 (-9 bp, + 8 bp) | N/A | NG_000006.1:g.34010_34018delinsTACTTCCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34010 |
| 2493 | CD 40 AAG>AA- | N/A | HBA2:c.123delG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34015 |
| 373 | CD 42 TAC>CAC [Tyr>His] | Hb Barika | HBA2:c.127T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34019 |
| 527 | CD 43 TTC>GTC [Phe>Val] | Hb Torino | HBA1:c.130T>G | HBA2:c.130T>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34022, 37826 |
| 528 | CD 43 TTC>ATC [Phe>Ile] | Hb Sens | HBA2:c.130T>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34022 |
| 2214 | CD 43 TTC>T-C | N/A | HBA2:c.131delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34023 |
| 529 | CD 43 TTC>TTG [Phe>Leu] | Hb Hirosaki | HBA2:c.132C>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34024 |
| 2215 | CD 43/44 -C | N/A | HBA2:c.132delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34024 |
| 2376 | CD 46 TTC>TCC [Phe>Ser] | Hb Lake Tapawingo | HBA2:c.140T>C | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34032 |
| 2216 | CD 47 -A | N/A | HBA2:c.143delA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34035 |
| 374 | CD 49 -GC | N/A | HBA2:c.149_150delGC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34041 |
| 2217 | CD 51/52 +G | N/A | HBA2:c.156_157insG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34048 |
| 376 | CD 54 (CAG>TAG) | N/A | HBA2:c.163C>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34055 |
| 379 | CD 59 GGC>CGC [Gly>Arg] | Hb Zurich-Albisrieden | HBA2:c.178G>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34070 |
| 377 | CD 59 GGC>GAC [Gly>Asp] | Hb Adana | HBA2:c.179G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34071 |
| 575 | CD 59 GGC>GTC [Gly>Val] | Hb Tottori | HBA1:c.179G>T | HBA2:c.179G>T | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34071, 37875 |
| 3286 | CD 61 AAG>TAG [Lys>STOP] | N/A | HBA2:c.184A>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34076 |
| 583 | CD 62 GTG>ATG [Val>Met] | Hb Evans | HBA2:c.187G>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34079 |
| 384 | CD 66 CTG>CCG [Leu>Pro] | Hb Dartmouth | HBA2:c.190T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34082 |
| 2218 | CD 63-76 (-42 bp) | N/A | HBA2:c.190_231del | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34082 |
| 591 | CD 65 GCG>GTG [Ala>Val] | Hb Bois Guillaume | HBA1:c.197C>T | HBA2:c.197C>T | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34089, 37893 |
| 611 | CD 75 (-GAC) | Hb Watts | HBA2:c.226_228del | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34118 |
| 629 | CD 80 CTG>GTG [Leu>Val] | Hb Conakry | HBA2:c.241C>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34133 |
| 630 | CD 80 CTG>CGG [Leu>Arg] | Hb Ann Arbor | HBA2:c.242T>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34134 |
| 643 | CD 86 CTG>CGG [Leu>Arg] | Hb Moabit | HBA1:c.260T>G | HBA2:c.260T>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34152, 37956 |
| 388 | CD 90 AAG>TAG | N/A | HBA2:c.271A>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34163 |
| 3572 | CD 90‐92 (-8bp): (‐AGCTTCGG) | N/A | HBA2:c.272_279delAGCTTCGG | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34164 |
| 666 | CD 91 CTT>CCT [Leu>Pro] | Hb Port Phillip | HBA2:c.275T>C | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34167 |
| 389 | CD 93 GTG>GGG [Val>Gly] | Hb Bronte | HBA2:c.281T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34173 |
| 3080 | CD 94 (+21 bp duplication) | Hb SKMC | HBA2:c.283_300+3dup | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34175 |
| 391 | IVS II-2 GT>GA donor | N/A | HBA2:c.300+2T>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34194 |
| 300 | -α3.7 (type I) (-α3.7) | N/A | NG_000006.1:g.34247_38050del | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34247 |
| 2220 | CD 101 CTA>CCA [Leu>Pro] | Hb Bishopstown | HBA2:c.305T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34339 |
| 698 | CD 103 CAC>CGC [His>Arg] | Hb Contaldo | HBA1:c.311A>G | HBA2:c.311A>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34345, 38156 |
| 2420 | CD 104 TGC>CGC [Cys>Arg] | Hb Iberia | HBA2:c.313T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34347 |
| 396 | CD 104 TGC>TAC [Cys>Tyr] | Hb Sallanches | HBA2:c.314G>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34348 |
| 397 | CD 108 ACC>AAC [Thr>Asn] | Hb Bleuland | HBA2:c.326C>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34360 |
| 398 | CD 109 (-C) | Hb Sciacca | HBA1:c.328delC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34362 |
| 399 | CD 109 CTG>CGG [Leu>Arg] | Hb Suan Dok | HBA2:c.329T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34363 |
| 2571 | CD 109 CTG>CCG [Leu>Pro] | Hb Milano | HBA1:c.329T>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34363 |
| 401 | CD 110 GCC>GAC [Ala>Asp] | Hb Petah Tikva | HBA1:c.332C>A | HBA2:c.332C>A | α1 or α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34366 |
| 709 | CD 112 CAC>CGC [His>Arg] (Hb Serbia) | Hb Strumica | HBA1:c.338A>G | HBA2:c.338A>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34372, 38183 |
| 402 | CD 112/113 -C | N/A | HBA2:c.339delC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34373 |
| 404 | CD 113-116 (-12 bp) & CD 112 (C>G) | Hb Leida | HBA2:c.[339C>G;340_351delCTCCCCGCCGAG] | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34373 |
| 2527 | CD 114 (+CC) | N/A | HBA2:c.344_345dup | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34378 |
| 405 | CD 116 GAG>TAG | N/A | HBA2:c.349G>T | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34383 |
| 2221 | CD 115 -GAGTTCACCCC [166 aa] | N/A | HBA2:c.349_359delGAGTTCACCCC | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34383 |
| 2023 | CD 117 TTC>TCC [Phe>Ser] | Hb Foggia | HBA2:c.353T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34387 |
| 731 | CD 123 GCC>ACC [Ala>Thr] (Hb Croxley Green) | Hb Santa Barnabas | HBA2:c.370G>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34404 |
| 734 | CD 124 TCC>CCC [Ser>Pro] | Hb Policoro | HBA2:c.373T>C | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34407 |
| 408 | CD 125 CTG>CCG [Leu>Pro] | Hb Quong Sze | HBA2:c.377T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34411 |
| 409 | CD 125 CTG>CGG [Leu>Arg] | Hb Plasencia | HBA2:c.377T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34411 |
| 736 | CD 125 CTG>CAG [Leu>Gln] | Hb West-Einde | HBA2:c.377T>A | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34411 |
| 412 | CD 129 CTG>CCG [Leu>Pro] | Hb Utrecht | HBA2:c.389T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34423 |
| 413 | CD 130 GCT>CCT [Ala>Pro] | Hb Sun Prairie | HBA2:c.391G>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34425 |
| 414 | CD 131 TCT>CCT [Ser>Pro] | Hb Questembert | HBA2:c.394T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34428 |
| 415 | CD 132 GTG>GGG [Val>Gly] | Hb Caen | HBA1:c.398T>G | HBA2:c.398T>G | α1 or α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34432 |
| 417 | CD 136 CTG>CCG [Leu>Pro] | Hb Bibba | HBA2:c.410T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34444 |
| 766 | CD 136 CTG>CGG [Leu>Arg] | Hb Toyama | HBA1:c.410T>G | HBA2:c.410T>G | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34444, 38255 |
| 768 | CD 138 TCC>CCC [Ser>Pro] | Hb Attleboro | HBA1:c.415T>C | HBA2:c.415T>C | α1 or α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 34449, 38260 |
| 418 | CD 142 (TAA>CAA) >172aa | Hb Constant Spring | HBA2:c.427T>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34461 |
| 419 | CD 142 (TAA>AAA) >172aa | Hb Icaria | HBA2:c.427T>A | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34461 |
| 421 | CD 142 (TAA>GAA) >172aa | Hb Seal Rock | HBA2:c.427T>G | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34461 |
| 420 | CD 142 TAA>TCA >172aa | Hb Koya Dora | HBA2:c.428A>C | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34462 |
| 422 | CD 142 (TAA>TAT) >172aa | Hb Paksé | HBA2:c.429A>T | α2 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 34463 |
| 2230 | -α3.7 (type II) | N/A | NG_000006.1:g.34478_38288del | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34478 |
| 2226 | 3'UTR +46 C>A | N/A | HBA2:c.*46C>A | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34509 |
| 428 | 3'UTR -16 bp | N/A | HBA2:c.*74_*89delCCTTCCTGGTCTTTGA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34537 |
| 425 | Poly A (AATAAA>AATGAA) (αPolyA2) | N/A | HBA2:c.*92A>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34555 |
| 426 | Poly A (AATAAA>AATA--) | N/A | HBA2:c.*93_*94delAA | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34556 |
| 424 | Poly A (AATAAA>AATAAG) (αPolyA1, αT-Saudi) | N/A | HBA2:c.*94A>G | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34557 |
| 427 | Poly A (AATAAA>AATAAC) | N/A | HBA2:c.*94A>C | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34557 |
| 2231 | -α3.7 (type III) | N/A | NG_000006.1:g.34570_38381del | α2, α1, α3.7 hybrid | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 34570 |
| 303 | -α2.7 | N/A | NG_000006.1:g.36664_39364del2701 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 36664 |
| 304 | -α3.5 | N/A | NG_000006.1:g.37464_40964del3501 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37464 |
| 340 | CAP +22 T>C | N/A | HBA1:c.-16T>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37564 |
| 2203 | CAP +29 (G>C) | N/A | HBA1:c.-9G>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37571 |
| 341 | Init CD ATG>GTG | N/A | HBA1:c.1A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37580 |
| 3147 | Init CD ATG>AAG [Met>Lys] | N/A | HBA1:c.2T>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37581 |
| 347 | CD 14 TGG>CGG [Trp>Arg] | Hb Evanston | HBA1:c.43T>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37622 |
| 349 | CD 14 TGG>TAG [Trp>STOP] | N/A | HBA1:c.44G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37623 |
| 468 | CD 16 AAG>ATG [Lys>Met] | Hb Harbin | HBA1:c.50A>T | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37629 |
| 2205 | CD 20 +T | N/A | HBA1:c.62_63insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37641 |
| 3266 | CD 22 GGC>GGT [Gly>Gly] | N/A | HBA1:c.69C>T | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37648 |
| 3267 | CD 23 GAG>TAG | N/A | HBA1:c.70G>T | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37649 |
| 358 | IVS I-1 AGGT>AGAT donor | N/A | HBA1:c.95+1G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37675 |
| 2204 | IVS I-4 A>G | N/A | HBA1:c.95+4A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37678 |
| 361 | IVS I-5 G>A | N/A | HBA1:c.95+5 G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37679 |
| 2212 | IVS I-45 G>C | N/A | HBA1:c.95+45G>C | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37719 |
| 364 | IVS I-117 GCAGGA>GCAAGA acceptor | N/A | HBA1:c.96-1G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37791 |
| 2986 | CD 32 ATG>ACG [Met>Thr] | Hb Bridlington | HBA1:c.98T>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37794 |
| 370 | CD 37 -CCC [-Pro) | Hb Heraklion | HBA1:c.112_114delCCC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37808 |
| 371 | CD 39 (-ACC) [-Thr] | Hb Taybe | HBA1:c.118_120del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37814 |
| 3557 | CD 43 TTC>CTC [Phe>Leu] | Hb Vanvitelli | HBA1:c.130T>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37826 |
| 375 | CD 51-55 (-13 bp deletion) | N/A | HBA1:c.155_167delGCTCTGCCCAGGT | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37851 |
| 3560 | CD 52 TCT>TGT [Ser>Cys] | Hb Dongguan | HBA1:c.158C>G | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37854 |
| 3175 | CD 58 CAC>CTC [His>Leu] | Hb Kirklareli | HBA1:c.176A>T | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37872 |
| 3280 | CD 59 GGC>CGC [Gly>Arg] | Hb Zurich-Albisrieden | HBA1:c.178G>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37874 |
| 378 | CD 59 GGC>GAC [Gly>Asp] | Hb Adana | HBA1:c.179G>A | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37875 |
| 380 | CD 61 (-AAG) | Hb Clinic | HBA1:c.184_186del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37880 |
| 381 | CD 62 (-GTG) [-Val] | Hb Aghia Sophia | HBA1:c.187_189del | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37883 |
| 382 | CD 62 GTG>-TG | Hb Champaign | HBA1:c.187delG | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37883 |
| 2347 | CD 62 -G | N/A | HBA1:c.189delG | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37885 |
| 383 | CD 64-74 (-33 bp) | N/A | HBA1:c.193_225del33 | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37889 |
| 599 | CD 70 GTG>ATG [Val>Met] | Hb Haaksbergen | HBA1:c.211G>A | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37907 |
| 385 | CD 74/75 -GAC [- Asp] | N/A | HBA1:c.212_214delGAC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37908 |
| 609 | CD 74 GAC>GGC [Asp>Gly] | Hb Chapel Hill | HBA1:c.224A>G | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37920 |
| 386 | CD 78 -C | N/A | HBA1:c.237delC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37933 |
| 2219 | CD 81 -T | N/A | HBA2:c.244delT | α2 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37940 |
| 387 | CD 82-84 (-9 bp) | N/A | HBA1:c.247_255del | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37943 |
| 633 | CD 82 GCC>ACC (Ala>Thr) | Hb Hagley Park | HBA1:c.247G>A | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37943 |
| 2281 | CD 83 CTG>CGG [Leu>Arg] | Hb Ahvaz | HBA2: c.251T>G | α2 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37947 |
| 390 | CD 93-99 (+21 bp) | N/A | HBA1:c.280_300ins21 | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 37976 |
| 672 | CD 93 GTG>GCG [Val>Ala] | Hb Die | HBA1:c.281T>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37977 |
| 2539 | IVS II-3 (+21bp) | Hb SKMC | HBA1:c.283_300+3dup | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 37979 |
| 677 | CD 94 GAC>GCC [Asp>Ala] | Hb Bassett | HBA1:c.284A>C | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 37980 |
| 2222 | IVS II-147 C>G | N/A | HBA1:c.301-3C>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38143 |
| 393 | IVS II-148 A>G consensus | N/A | HBA1:c.301-2A>G | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38144 |
| 395 | CD 104 TGC>AGC [Cys>Ser] | Hb Oegstgeest | HBA1:c.313T>A | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38158 |
| 2340 | CD 104 TGC>TGG [Cys>Trp] | Hb Donnington | HBA1:c.315C>G | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38160 |
| 2224 | CD 110-114 (-13 bp) | N/A | HBA1:c.333_345delCGCCCACCTCCCC | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38178 |
| 724 | CD 119/120 +ATC [+Ile] | Hb Phnom Penh | HBA1:c.354_355insATC | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38200 |
| 406 | CD 119 CCT>TCT [Pro>Ser] (Hb Bemalda P, Hb Bernalda) | Hb Groene Hart | HBA1:c.358C>T | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38203 |
| 407 | CD 123 GCC >CCC [Ala>Pro] | Hb Voreppe | HBA1:c.370G>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38215 |
| 411 | CD 129 CTG>CCG [Leu>Pro] | Hb Tunis-Bizerte | NM_000558.3(HBA1):c.389T>C | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38234 |
| 749 | CD 130 GCT>GTT [Ala>Val] | Hb Westborough | HBA1:c.392C>T | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 38237 |
| 3281 | CD 130 (+T) | Hb Sichuan | HBA1:c.393_394insT | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38238 |
| 416 | CD 131 (+T) >175aa | Hb Pak Num Po | HBA1:c.396dup | α1 | Causative | α-thalassaemia, α-chain variant, Haemolytic anaemia | NG_000006.1 | 38241 |
| 760 | CD 134 -C | Hb Senlis | HBA1:c.404delC | α1 | Causative | α-chain variant, Haemolytic anaemia | NG_000006.1 | 38249 |
| 2225 | Poly A (G>A) AATAAAG>AATAAAA | N/A | HBA1:c.*96G>A | α1 | Causative | α-thalassaemia, Haemolytic anaemia | NG_000006.1 | 38370 |
| 1542 | Dutch I (εγδβ)0 | N/A | NC_000011.10:g.5229432_5329263del | βLCR, ε, Aγ, Gγ, δ, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
| 2418 | Swiss (εγδβ)0 | N/A | NC_000011.10:g.(4002734_4002784)_ (6907712_6907762)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
| 2548 | Inv-Del English V | N/A | NC_000011.10:g.5194460_5253454invdel5194460_5194542del5253454_5375965 | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | |
| 3570 | 1.78Mb εγδβ(0) del (Bedouin) | N/A | NC_000011.10:g.(4302665_4322227)_(6099443_6100105)del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
| 3578 | 2.2 Mb deletion | N/A | NC_000011.10:g.4052720_6253287del | βLCR, ε, Aγ, Gγ, δ, β, pseudo β | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | |
| 291 | Czech (4237 bp deletion) | N/A | NG_000007.3:g.67258_71501del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 293 | Cape Verdean | N/A | NG_000007.3:g.71548_79271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 294 | Asian Indian (10329 bp deletion) | N/A | NG_000007.3:g.(67531_67533)_(77874_77876)del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 295 | Australian (Anglo Saxon) (12023 bp deletion) | N/A | NC_000011.10:g.5215894_5227926del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 299 | Italian (~67 kb deletion) | N/A | N/A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 2123 | 7719 bp deletion | N/A | NG_000007.3:g.71550_79270del7719 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 0 |
| 2419 | Senegalese δ(0)β(+) | N/A | NG_000007.3:g.(63154_63209)_(70570_70625)del7417 | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 0 |
| 3577 | 59 Kb deletion | N/A | NC_000011.10:g.5236469_5295261del | βLCR, ε, Aγ, Gγ | Causative | εγδβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 2355 |
| 3566 | CD 24 GGA>GAA [Gly>Glu] | Hb F-Wentzville | HBG2:c.74G>A | Gγ | Causative | γ-chain variant, Haemolytic anaemia | NG_000007.3 | 42961 |
| 1526 | Black (Aγδβ)0 | N/A | NC_000011.10:g.5212727_5248576del | Aγ, δ, β, pseudo β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 49040 |
| 1506 | Indian (δβ)0 (32.6 kb GγΑγ(δβ)0 Indian del) | N/A | NC_000011.10:g.5214461_5247124del | δ, β, pseudo β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 50492 |
| 3792 | N/A | Hb Lepore-Hong Kong | NG_000007.3:g.63154_70565del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 63154 |
| 1507 | Sicilian (δβ)0 | N/A | NG_000007.3:g.64336_77738del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 64336 |
| 1513 | Thai/Vietnamese (δβ)0 (Thai (δβ)0 , Vietnamese (δβ)0 ) | N/A | NG_000007.3:g.64384_76993del | δ, β | Causative | δβ-thalassaemia, Haemolytic anaemia | NG_000007.3 | 64384 |
| 2482 | CD 137 -GTG [-Val] (Hb Anti-Lepore Lincoln Park) | Hb Lincoln Park | HBD:c.412_414delGTG | δ | Causative | δ-chain variant, Haemolytic anaemia | NG_000007.3 | 64620 |
| 298 | Filipino (~45 kb deletion) | N/A | NC_000011.10:g.5112882 _5231358del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66258 |
| 292 | Turk (~7.6 kb deletion) | N/A | NG_000007.3:g.[52524_60162del;66278_73952del] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66278 |
| 2283 | South-Italy | N/A | NC_000011.10:g.5164564_5230714del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 66902 |
| 2157 | Indian (4056 bp deletion) | N/A | NG_000007.3:g.67357_71413del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 67357 |
| 296 | Dutch (12620 bp deletion) | N/A | NG_000007.3:g.68071_80682del12612 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 68071 |
| 289 | Croatian (1605 bp deletion) | N/A | NG_000007.3:g.69561_71164del1604 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 69561 |
| 288 | Black, British (1393 bp deletion) | N/A | NG_000007.3:g.70060_71452del1393 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70060 |
| 2125 | Afghan (909 bp deletion) | N/A | NG_000007:g.70067_70976del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70067 |
| 284 | 468 bp deletion | N/A | NG_000007.3:g.70070_70537del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70070 |
| 285 | Black (532 bp deletion) | N/A | HBB:c.-504_28del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70091 |
| 1 | -190 (G>A) | N/A | HBB:c.-240G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70355 |
| 2122 | 125 bp deletion | N/A | NG_000007.3:g.70360_70485del125 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70360 |
| 2153 | Kabylia deletion/insertion | N/A | NG_000007.3:g.70417_72458delinsATAAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70417 |
| 283 | 290 bp deletion | N/A | HBB:c.-176_92+25del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70419 |
| 2 | -102 (C>A) | N/A | HBB:c.-152C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70443 |
| 3 | -101 (C>T) | N/A | HBB:c.-151C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
| 4 | -101 (C>G) | N/A | HBB:c.-151C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70444 |
| 5 | -93 C>G | N/A | HBB:c.-143C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70452 |
| 6 | -92 (C>T) | N/A | HBB:c.-142C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70453 |
| 7 | -90 (C>T) | N/A | HBB:c.-140C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
| 3224 | -90 (C>G) | N/A | HBB:c.-140C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70455 |
| 8 | -88 (C>T) | N/A | HBB:c.-138C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
| 9 | -88 (C>A) | N/A | HBB:c.-138C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
| 2178 | -88 C>G | N/A | HBB:c.-138C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70457 |
| 10 | -87 C>G | N/A | HBB:c.-137C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
| 11 | -87 (C>T) | N/A | HBB:c.-137C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
| 12 | -87 (C>A) | N/A | HBB:c.-137C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70458 |
| 13 | -86 C>G | N/A | HBB:c.-136C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
| 14 | -86 (C>A) | N/A | HBB:c.-136C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70459 |
| 15 | -73 (A>T) | N/A | HBB:c.-123A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70472 |
| 2997 | -72 T>A | N/A | HBB:c.-122T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70473 |
| 2171 | -71 C>T | N/A | HBB:c.-121C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70474 |
| 16 | -56 G>C | N/A | HBB:c.-106G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70489 |
| 17 | -50 G>A | N/A | HBB:c.-100G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70495 |
| 2172 | -41 A>T | N/A | HBB:c.-91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70504 |
| 18 | -32 (C>A) | N/A | HBB:c.-82C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
| 19 | -32 (C>T) | N/A | HBB:c.-82C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70513 |
| 20 | -31 (A>G) | N/A | HBB:c.-81A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
| 21 | -31 (A>C) | N/A | HBB:c.-81A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70514 |
| 22 | -30 (T>A) | N/A | HBB:c.-80T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
| 23 | -30 (T>C) | N/A | HBB:c.-80T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
| 2179 | -30 T>G | N/A | HBB:c.-80T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70515 |
| 24 | -29 to -26 (-AA) | N/A | HBB:c.-79_78delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
| 25 | -29 (A>G) | N/A | HBB:c.-79A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
| 26 | -29 (A>C) | N/A | HBB:c.-79A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70516 |
| 28 | -28 (A>C) | N/A | HBB:c.-78A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70517 |
| 29 | -28 (A>G) | N/A | HBB:c.-78A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis, Hb F levels | NG_000007.3 | 70517 |
| 30 | -27 (A>T) | N/A | HBB:c.-77A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
| 31 | -27 (-AA) | N/A | HBB:c.-77_-76delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70518 |
| 2175 | -26 A>C | N/A | HBB:c.-76A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70519 |
| 32 | -25 (G>C) | N/A | HBB:c.-75G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70520 |
| 282 | 105 bp deletion | N/A | HBB:c.-74_31del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70521 |
| 34 | CAP +1 (A>C) | N/A | HBB:c.-50A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70545 |
| 35 | CAP +8 (C>T) | N/A | HBB:c.-43C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70552 |
| 36 | CAP +10 (-T) (5'UTR +10 (-T)) | N/A | HBB:c.-41delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70554 |
| 38 | CAP +22 (G>A) | N/A | HBB:c.-29G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
| 3345 | CAP +22 (G>T) | N/A | HBB:c.-29G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70566 |
| 33 | -22 to +23 (+45 bp duplication) | N/A | NG_000007.3:g.70573_70617dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70573 |
| 39 | CAP +33 (C>G) | N/A | HBB:c.-18C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70577 |
| 2176 | CAP +39 C>T | N/A | HBB:c.-12C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70583 |
| 41 | CAP +45 (G>C) | Hb Odisha | HBB:c.-6G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70589 |
| 42 | Init CD ATG>GTG | N/A | HBB:c.1A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
| 43 | Init CD ATG>CTG | N/A | HBB:c.1A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70595 |
| 44 | Init CD ATG>ACG | N/A | HBB:c.2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
| 45 | Init CD ATG>AGG | N/A | HBB:c.2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
| 46 | Init CD ATG>AAG | N/A | HBB:c.2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70596 |
| 47 | Init CD ATG>ATC | N/A | HBB:c.3G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
| 48 | Init CD ATG>ATA | N/A | HBB:c.3G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
| 49 | Init CD ATG>ATT | N/A | HBB:c.3G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70597 |
| 50 | CD 1 (-G) | N/A | HBB:c.4delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70598 |
| 51 | CD 2-4 (-9 bp, +31 bp) | N/A | HBB:c.7_15delinsCCTGAGGTGAAGTCTGCCTGAGGAGAAGTCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
| 3437 | CD 2 CAT>-AT | Hb Bundelkhand | HBB:c.7delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70601 |
| 53 | CD 2/3 (+T); CD 5 (-C) | Hb Antalya | HBB:c.[9dupT; 17delC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603, 70611 |
| 3561 | CD 2 CAT/CA- | N/A | HBB:c.9delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70603 |
| 52 | CD 3 (+T) | N/A | HBB:c.11dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70605 |
| 55 | CD 4/5/6: CD 4 (ACT>ACA), CD 5 (CCT>TCT), CD 6 (GAG>TAG) | N/A | HBB:c.[15T>A;16C>T;19G>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70609, 70610, 70613 |
| 54 | CD 5 -CT | N/A | HBB:c.17_18delCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70611 |
| 2180 | CD 5/6 -TG | N/A | HBB:c.18_19delTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70612 |
| 56 | CD 6 (GAG>TAG) | N/A | HBB:c.19G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
| 58 | CD 6 (-G) | N/A | HBB:c.19delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
| 809 | CD 6 GAG>AAG [Glu>Lys] and CD 98 GTG>ATG [Val>Met] | Hb Kingsbury | HBB:c.[19G>A ;295G>A] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70613 |
| 810 | CD 6 GAG>AAG [Glu>Lys] | HbC | HBB:c.19G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70613 |
| 2184 | CD 6-14 (-26 bp) (26 bp deletion) | N/A | HBB:c.20_45del26bp | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70613 |
| 57 | CD 6 -A | N/A | HBB:c.20delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70614 |
| 824 | CD 6 GAG>GTG [Glu>Val] (Sickle-cell) | HbS | HBB:c.20A>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70614 |
| 3324 | CD 6 GAG>GTG [Glu>Val]; CD 139 AAT>AGT [Asn>Ser] | Hb S-Wake | HBB:c.[20A>T;419A>G] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70614, 71993 |
| 59 | CD 6-10 (-13 bp) | N/A | HBB:c.21_33delGGAGAAGTCTGCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70615 |
| 60 | CD 7 GAG>TAG | N/A | HBB:c.22G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70616 |
| 61 | CD 8 (-AA) | N/A | HBB:c.25_26delAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70619 |
| 2185 | CD 8/9 +AGAA | N/A | HBB:c.27_28insAGAA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70620 |
| 62 | CD 8/9 (+G) | N/A | HBB:c.27dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
| 3513 | CD 8 AAG>AA- | N/A | HBB:c.27delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70621 |
| 63 | CD 9 (+TA) | N/A | HBB:c.28_29insTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70622 |
| 64 | CD 9/10 (+T) | Hb Gaziantep | HBB:c.30dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70624 |
| 65 | CD 10 GCC>GCA [Ala>Ala] | N/A | HBB:c.33C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
| 66 | CD 10 (-C) | N/A | HBB:c.33delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70627 |
| 67 | CD 11 (-T) | N/A | HBB:c.36delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70630 |
| 68 | CD 14 (+T) | N/A | HBB:c.44dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
| 2553 | CD 14 CTG>C-G | N/A | HBB:c.44delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70638 |
| 69 | CD 14/15 (+G) | N/A | HBB:c.45dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70639 |
| 70 | CD 15 (-T) | N/A | HBB:c.46delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70640 |
| 72 | CD 15 TGG>TAG | N/A | HBB:c.47G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70641 |
| 73 | CD 15 TGG>TGA | N/A | HBB:c.48G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70642 |
| 71 | CD 15/16 (+G) | N/A | HBB:c.50dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
| 74 | CD 15/16 (-G) | N/A | HBB:c.50delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70644 |
| 75 | CD 16 GGC>GG- | N/A | HBB:c.51delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
| 76 | CD 16 GGC>GGT [Gly>Gly] | N/A | HBB:c.51C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70645 |
| 77 | CD 17 AAG>TAG [Lys>STOP] | N/A | HBB:c.52A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70646 |
| 78 | CD 17 (+A) | N/A | HBB:c.53dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70647 |
| 80 | CD 20-22 (GTGGATGAA>GTGAA) | N/A | HBB:c.64_67del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
| 81 | CD 20/21 (+G) | N/A | HBB:c.64dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70658 |
| 83 | CD 22 (GAA>TAA) | N/A | HBB:c.67G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70661 |
| 84 | CD 22-24 ( -7 bp): (-AAGTTGG) | N/A | HBB:c.68_74delAAGTTGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70662 |
| 85 | CD 24 (-G, +CAC) | N/A | HBB:c.74delinsCAC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
| 2174 | CD 24 -G | N/A | HBB:c.74delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70668 |
| 86 | CD 24 GGT>GGA [Gly>Gly] | N/A | HBB:c.75T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70669 |
| 281 | IVS I [3 end] -44 bp (44 bp deletion) | N/A | HBB:c.76_92+27del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70670 |
| 87 | CD 25/26 (+T) | N/A | HBB:c.78dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70672 |
| 88 | CD 26 GAG>AAG [Glu>Lys] | HbE | HBB:c.79G>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
| 89 | CD 26 (GAG>TAG) | N/A | HBB:c.79G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
| 90 | CD 26 (+T) | N/A | HBB:c.79_80insT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70673 |
| 895 | CD 26 GAG>GTG [Glu>Val] | Hb Henri Mondor | HBB:c.80A>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70674 |
| 91 | CD 27 GCC>TCC [Ala>Ser] | Hb Knossos | HBB:c.82G>T | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70676 |
| 92 | CD 27/28 (+C) | N/A | HBB:c.85dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
| 93 | CD 28 (-C) | N/A | HBB:c.85delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70679 |
| 900 | CD 28 CTG>ATG [Leu>Met] | Hb Chile | HBB:c.85C>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70679 |
| 94 | CD 28 CTG>CGG [Leu >Arg] | Hb Chesterfield | HBB:c.86T>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70680 |
| 902 | CD 28 CTG>CAG [Leu>Gln] | Hb Saint Louis | HBB:c.86T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70680 |
| 95 | CD 28/29 (-G) | N/A | HBB:c.89delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70683 |
| 96 | CD 29 (C>T) or IVS I (-3) GGC>GGT (Gly>Gly) | N/A | HBB:c.90C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70684 |
| 97 | CD 30 (A>G) or IVS I (-2) AGG>GGG (Arg>Gly) | N/A | HBB:c.91A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
| 98 | CD 30 (A>C) or IVS I (-2) AGG>CGG [Arg>Arg] | N/A | HBB:c.91A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
| 3484 | CD 30 (-A) or IVS I (-2) AGG>-GG | N/A | HBB:c.91delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70685 |
| 99 | CD 30 (G>A) or IVS I (-1) AGG>AAG (Arg>Lys) | N/A | HBB:c.92G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
| 100 | CD 30 (G>C) or IVS I (-1) AGG>ACG (Arg>Thr) (Hb Kairouan) | Hb Monroe | HBB:c.92G>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70686 |
| 101 | IVS I-1 G>A | N/A | HBB:c.92+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
| 102 | IVS I-1 (G>T) | N/A | HBB:c.92+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
| 103 | IVS I-1 (G>C) | N/A | HBB:c.92+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70687 |
| 104 | IVS I-2 (T>G) | N/A | HBB:c.92+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
| 105 | IVS I-2 (T>C) | N/A | HBB:c.92+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
| 106 | IVS I-2 (T>A) | N/A | HBB:c.92+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70688 |
| 107 | IVS I-5 (G>C) | N/A | HBB:c.92+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
| 108 | IVS I-5 (G>T) | N/A | HBB:c.92+5G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
| 109 | IVS I-5 (G>A) | N/A | HBB:c.92+5G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70691 |
| 111 | IVS I-6 (T>C) | N/A | HBB:c.92+6T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
| 3565 | IVS I-6 (T>G) | N/A | HBB:c.92+6T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70692 |
| 112 | IVS I-7 A>T | N/A | HBB:c.92+7A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
| 3276 | IVS I-7 A>G | N/A | HBB:c.92+7A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70693 |
| 280 | IVS I [3' end] (-25 bp) (25 bp deletion) | N/A | NC_000011.10(NM_000518.4):c.93-22_95del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
| 2173 | IVS I-109 (-T) | N/A | HBB:c.93-22delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70795 |
| 113 | IVS I-110 G>A | N/A | HBB:c.93-21G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70796 |
| 121 | IVS I [3' end] (-17 bp) (17 bp deletion) | N/A | HBB:c.93-17_93-1delTATTTTCCCACCCTTAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70800 |
| 114 | IVS I-116 (T>G) | N/A | HBB:c.93-15T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70802 |
| 124 | IVS I [3' end] (+22bp) | N/A | NG_000007.3:g.70807_70828dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70807 |
| 115 | IVS I-128 (T>G) | N/A | HBB:c.93-3T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70814 |
| 116 | IVS I-129 (A>C) | N/A | HBB:c.93-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
| 117 | IVS I-129 (A>G) | N/A | HBB:c.93-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70815 |
| 118 | IVS I-130 G>C | N/A | HBB:c.93-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
| 119 | IVS I-130 (G>A) | N/A | HBB:c.93-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70816 |
| 125 | CD 30/31 +CGG [+Arg] | N/A | HBB:c.93_94insCGG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70817 |
| 126 | CD 31 (-C) | N/A | HBB:c.94delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70818 |
| 127 | CD 32 CTG>CAG: CD 98 GTG>ATG | Hb Medicine Lake | HBB:c.[98T>A; 295G>A] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70822 |
| 913 | CD 32 CTG>CAG [Leu>Gln] | Hb Clermont Ferrand | HBB:c.98T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70822 |
| 131 | CD 33-35 (-TGGTCT) | Hb Dresden | HBB:c.101_106delTGGTCT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70825 |
| 129 | CD 33/34 (GTGGTC>GTC) | Hb Korea | HBB:c.102_104del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
| 130 | CD 33-34 (-G) | N/A | HBB:c.102_103delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70826 |
| 132 | CD 35 TAC>TGC [Tyr>Cys] | N/A | HBB:c.107A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70831 |
| 922 | CD 35 TAC>TTC [Tyr>Phe] | Hb Philly | HBB:c.107A>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70831 |
| 133 | CD 35 TAC>TAA | N/A | HBB:c.108C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70832 |
| 128 | CD 36 CCT>C-T (CD 36 (-C)) | N/A | HBB:c.110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70834 |
| 135 | CD 36-39 (-8 bp) | N/A | HBB:c.111_118delTTGGACCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70835 |
| 134 | CD 36/37 (-T) | N/A | HBB:c.112delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70836 |
| 138 | CD 37 (TGG>TAG) | N/A | HBB:c.113G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70837 |
| 136 | CD 37 (-G) | N/A | HBB:c.114delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
| 137 | CD 37 (TGG>TGA) | N/A | HBB:c.114G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
| 139 | CD 37-39 (-7 bp): (-GACCCAG) | N/A | HBB:c.114_120del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70838 |
| 141 | CD 38/39 (-CC) | N/A | HBB:c.117_118delCC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70841 |
| 140 | CD 38/39 (-C) | N/A | HBB:c.118delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
| 142 | CD 39 CAG>TAG [Gln>STOP] | N/A | HBB:c.118C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70842 |
| 2393 | CD 39 -A | N/A | HBB:c.119delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70843 |
| 143 | CD 40 (-G) | N/A | HBB:c.123delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
| 144 | CD 40 (+86 bp) (HGSA) | N/A | HBB:c.123_208dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70847 |
| 145 | CD 40/41 (+T) | N/A | HBB:c.125dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70849 |
| 146 | CD 41 (-C) | N/A | HBB:c.126delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
| 147 | CD 41/42 (-CTTT) (CD 41/42 (-TTCT), CD 41/42 (-TCTT)) | N/A | HBB:c.126_129delCTTT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70850 |
| 2387 | CD 67 GTG>ATG [Val>Met] AND CD 41 TTC>TTG [Phe>Leu] | Hb Brevedent | HBB:c.[202G>A ;126C>G] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70850 |
| 2461 | CD 42 TTT>ATT [Phe>Ile] | Hb Oslo | HBB:c.127T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70851 |
| 148 | CD 42/43 (+T) | N/A | HBB:c.129dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70853 |
| 149 | CD 42/43 (+G) | N/A | HBB:c.130dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
| 150 | CD 43 (GAG>TAG) | N/A | HBB:c.130G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70854 |
| 946 | CD 43-46 (-9bp) | Hb Niteroi | HBB:c.131_139del | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70855 |
| 151 | CD 44 -C | N/A | HBB:c.135delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70859 |
| 2531 | CD 45 TTT>GTT [Phe>Val] | Hb Duc Pho | HBB:c.136T>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70860 |
| 956 | CD 45 TTT>TAT [Phe>Tyr] | Hb Den Haag | HBB:c.137T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70861 |
| 152 | CD 45 (-T) | N/A | HBB:c.138delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
| 153 | CD 45 (+T) | N/A | HBB:c.138dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
| 154 | CD 45/46 (+A) | N/A | HBB:c.138_139insA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70862 |
| 155 | CD 47 (+A) | N/A | HBB:c.143dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
| 156 | CD 47/48 (+ATCT) | N/A | HBB:c.143_146dupATCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70867 |
| 2187 | CD 48 -T | N/A | HBB:c.146delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70870 |
| 157 | CD 49 (-C) | N/A | HBB:c.150delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70874 |
| 158 | CD 50 (-T) | N/A | HBB:c.153delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70877 |
| 159 | CD 51 (-C) | N/A | HBB:c.155delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70879 |
| 160 | CD 53 (-T) | N/A | HBB:c.162delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70886 |
| 161 | CD 53/54 (+G) | N/A | HBB:c.163dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70887 |
| 162 | CD 54 -T | N/A | HBB:c.165delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
| 164 | CD 54-58 (-13bp) | N/A | HBB:c.165_177delTATGGGCAACCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70889 |
| 163 | CD 54/55 (+A) | N/A | HBB:c.166dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
| 165 | CD 55 (-A) | N/A | HBB:c.166delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70890 |
| 166 | CD 56-60 (+14 bp) | N/A | HBB:c.170_183dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70894 |
| 167 | CD 58 (+C) | N/A | HBB:c.176dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70900 |
| 169 | CD 59 (AAG>TAG) | N/A | HBB:c.178A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70902 |
| 168 | CD 59 -A | N/A | HBB:c.179delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70903 |
| 170 | CD 60 GTG>GAG [Val>Glu] | Hb Cagliari | HBB:c.182T>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70906 |
| 172 | CD 61 (AAG>TAG) | N/A | HBB:c.184A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70908 |
| 2190 | CD 62-83 (+65 bp) | N/A | HBB:c.187_251dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70911 |
| 3589 | CD 62-65 (-12bp) | N/A | HBB:c.187_198delGCTCATGGCAAG | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 70911 |
| 171 | CD 62-64 (-7bp) | N/A | HBB:c.189_195delTCATGGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70913 |
| 1008 | CD 63 CAT>AAT [His>Asn] | Hb Haná | HBB:c.190C>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70914 |
| 173 | CD 64 (-G) | N/A | HBB:c.194delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70918 |
| 2525 | CD 68/69 (+AAAGTGCTC) | Hb Bronx | HBB:c.199_207dupAAAGTGCTC | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70923 |
| 2188 | CD 66 -A | N/A | HBB:c.201delA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70925 |
| 1021 | CD 67 GTG>ATG [Val>Met] (Hb Bristol-Alesha, Hb Bristol) | Hb Alesha | HBB:c.202G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70926 |
| 175 | CD 67 (-TG) | N/A | HBB:c.203_204delGT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70927 |
| 1023 | CD 67 GTG>GGG [Val>Gly] | Hb Manukau | HBB:c.203T>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70927 |
| 2522 | CD 69 GGT>G-T | N/A | HBB:c.209delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70933 |
| 2189 | CD 69 -T | N/A | HBB:c.210delT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70934 |
| 1033 | CD 70 GCC>CCC [Ala>Pro] | Hb Abington | HBB:c.211G>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70935 |
| 1035 | CD 70 GCC>GGC [Ala>Gly] | Hb Hershey | HBB:c.212C>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70936 |
| 176 | CD 71 (+T) | N/A | HBB:c.216dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70940 |
| 177 | CD 71/72 (+A) | N/A | HBB:c.217dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
| 178 | CD 72-73 (-AGTGA, +T) | N/A | HBB: c.217_221delAGTGAinsT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70941 |
| 2181 | CD 72/73 (+T) | N/A | HBB:c.219dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70943 |
| 1045 | CD 74 GGC>AGC [Gly>Ser] | Hb Kokomo | HBB:c.223G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70947 |
| 1046 | CD 74 GGC>CGC [Gly>Arg] | Hb Aalborg | HBB:c.223G>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70947 |
| 179 | CD 75 (-C) | N/A | HBB:c.226delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70950 |
| 180 | CD 76 GCT>--T (-GC) | N/A | HBB:c.229_230delGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70953 |
| 181 | CD 76 (-C) | N/A | HBB:c.230delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70954 |
| 182 | CD 78 CTG>-TG | N/A | HBB:c.235delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70959 |
| 3225 | CD 78/85 (-20bp) | N/A | HBB:c.237_256delGGACAACCTCAAGGGCACCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70961 |
| 183 | CD 80/81 (-C) | N/A | HBB:c.244delC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
| 184 | CD 81-87 (-22 bp) | N/A | HBB:c.244_265del22 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70968 |
| 2534 | CD 83 GGC>AGC [Gly>Ser] | Hb Basking Ridge | HBB:c.250G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70974 |
| 185 | CD 82/83 (-G) | N/A | HBB:c.251delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70975 |
| 186 | CD 84-86 (-8 bp): (-CACCTTTG) | N/A | HBB:c.253_260del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70977 |
| 187 | CD 84/85 (+C) | N/A | HBB:c.255dupC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70979 |
| 188 | CD 84-86 (+T) | N/A | HBB:c.258dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70982 |
| 189 | CD 88 (+T) | N/A | HBB:c.266dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
| 190 | CD 88 (-TG) | N/A | HBB:c.266_267del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70990 |
| 191 | CD 89/90 (AGTGAG>AGAG) | N/A | HBB:c.270_271del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70994 |
| 192 | CD 90 GAG>TAG | N/A | HBB:c.271G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70995 |
| 1118 | CD 94/95 +15 bp [+Glu-Leu-His-Cys-Asp] | Hb Fairfax | HBB:c.271_285dupGAGCTGCACTGTGAC | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 70995 |
| 3133 | IVS II-1 G>A and CD 91 CTG>TTG [Leu>Leu] | N/A | HBB:c.[315+1G>A; 274C>T] | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70998, 71040 |
| 193 | CD 91 CTG>C-G | Hb Morgantown | HBB:c.275del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
| 194 | CD 91 (+T) | N/A | HBB:c.275dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 70999 |
| 1109 | CD 92 CAC>CAG [His>Gln] (Hb Istanbul) | Hb Saint Etienne | HBB:c.279C>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71003 |
| 195 | CD 93/94 (+TG) | Hb Agnana | HBB:c.282_283dupTG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71006 |
| 196 | CD 95 (+A) | N/A | HBB:c.287dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71011 |
| 1131 | CD 98 GTG>ATG [Val>Met] (Hb San Francisco (Pacific), Hb Ube-1) | Hb Köln | HBB:c.295G>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71019 |
| 1133 | CD 98 GTG>GAG [Val>Glu] | Hb Mainz | HBB:c.296T>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71020 |
| 198 | CD 100 (-CC,+TCTGAGAACTT) >158aa | N/A | HBB:c.301_302delCCinsTCTGAGAACTT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71025 |
| 1148 | CD 101 GAG>GCG | Hb Youngstown | Hb St Mary's | HBB:c.305A>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71029 |
| 2279 | CD 102 AAC>ATCAC | N/A | HBB:c.308insTC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71032 |
| 199 | IVS II-1 (-G) | N/A | HBB:c.315+1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
| 200 | IVS II-1 G>A | N/A | HBB:c.315+1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
| 201 | IVS II-1 G>C | N/A | HBB:c.315+1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
| 202 | IVS II-1 G>T | N/A | HBB:c.315+1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71040 |
| 203 | IVS II-2 T>C | N/A | HBB:c.315+2T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 204 | IVS II-2 (T>A) | N/A | HBB:c.315+2T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 205 | IVS II-2 (-T) | N/A | HBB:c.315+2del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 2182 | IVS II-2 -TGAGTCTATGGG | N/A | HBB:c.315+2_315+13delTGAGTCTATGGG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 3226 | IVS II-2 T>G | N/A | HBB:c.315+2T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71041 |
| 207 | IVS II 4/5 -AG | N/A | NG_000007.3:g.71043_71044delAG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71043 |
| 208 | IVS II-5 (G>C) | N/A | HBB:c.315+5G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71044 |
| 209 | IVS II-535 - CD 108 (+23, -310, +28) | Hb Jambol | HBB:c.[316-300_327delinsCAGGTGCCATCTGTCACCCTTTTCTTTG;316-316_316-315insAATATATTTTTAATATACTTTTT] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71590 |
| 286 | 619 bp deletion (Asian Indian) | N/A | NG_000007.3:g.71609_72227del619 | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71609 |
| 210 | IVS II-613 (C>T) | N/A | HBB:c.316-238C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71652 |
| 211 | IVS II-654 C>T | N/A | HBB:c.316-197C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71693 |
| 212 | IVS II-705 (T>G) | N/A | HBB:c.316-146T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71744 |
| 213 | IVS II-726 A>G | N/A | HBB:c.316-125A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71765 |
| 214 | IVS II-745 C>G | N/A | HBB:c.316-106C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71784 |
| 2200 | IVS II-765 L1 insertion (+CTGCTTTTATTTT) | N/A | HBB:c.316-98_316-86dup | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71792 |
| 215 | IVS II-761 A>G | N/A | HBB:c.316-90A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71800 |
| 2183 | IVS II-781 C>G | N/A | HBB:c.316-70C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71820 |
| 216 | IVS II-815 (C>T) | N/A | HBB:c.316-36C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71854 |
| 217 | IVS II-837 (T>G) | N/A | HBB:c.316-14T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71876 |
| 218 | IVS II-843 (T>G) | N/A | HBB:c.316-8T>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71882 |
| 219 | IVS II-844 (C>A) | N/A | HBB:c.316-7C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
| 220 | IVS II-844 (C>G) | N/A | HBB:c.316-7C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71883 |
| 221 | IVS II-848 (C>A) | N/A | HBB:c.316-3C>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
| 222 | IVS II-848 (C>G) | N/A | HBB:c.316-3C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71887 |
| 223 | IVS II-849 (A>G) | N/A | HBB:c.316-2A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
| 224 | IVS II-849 (A>C) | N/A | HBB:c.316-2A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71888 |
| 225 | IVS II-850 G>C | N/A | HBB:c.316-1G>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
| 226 | IVS II-850 (G>A) | N/A | HBB:c.316-1G>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
| 227 | IVS II-850 (G>T) | N/A | HBB:c.316-1G>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
| 228 | IVS II-850 (-G) | N/A | HBB:c.316-1delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71889 |
| 2379 | CD 6 GAG>GTG [Glu>Val] AND CD 105 CTC>CCC [Leu>Pro] | Hb S-San Martin | HBB:c.[20A>T ;317T>C] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71891 |
| 229 | CD 106 (CTG >GTG) Leu to Val (Hb Federico II) | Hb L'Aquila | HBB:c.319C>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71893 |
| 230 | CD 106 CTG>CGG [Leu>Arg] | Hb Terre Haute | HBB:c.320T>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71894 |
| 231 | CD 107 (+G) | N/A | HBB:c.323dupG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
| 2191 | CD 107-111 (-12 bp): (-GCAACGTGCTGG) | N/A | HBB:c.323_334del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71897 |
| 232 | CD 108-112 (-12 bp) Asn-Val-Leu-Val-Cys to Ser | N/A | HBB:c.326_337delACGTGCTGGTCT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71900 |
| 1173 | CD 108 AAC>AGC [Asn>Ser] (Hb Serres) | Hb Santa Juana | HBB:c.326A>G | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71900 |
| 233 | CD 109 (-G) >156aa | Hb Manhattan | HBB:c.328delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71902 |
| 234 | CD 110 CTG>CCG [Leu>Pro] | Hb Showa-Yakushiji | HBB:c.332T>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71906 |
| 1180 | CD 111 GTC>TTC [Val>Phe] | Hb Peterborough | HBB:c.334G>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71908 |
| 1181 | CD 111 GTC>GCC [Val>Ala] | Hb Stanmore | HBB:c.335T>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71909 |
| 235 | CD 112 (TGT>TGA) | N/A | HBB:c.339T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
| 2192 | CD 114/115 (+TGTGCTG) | N/A | HBB:c.339_345dupTGTGCTG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71913 |
| 236 | CD 113 (-G) >156aa | N/A | HBB:c.340delG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71914 |
| 238 | CD 114 (-CT, +G) >156aa | Hb Geneva | HBB:c.343_344delinsG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71917 |
| 237 | CD 114 CTG>CCG [Leu>Pro] (Hb Brescia) | Hb Durham-N.C. | HBB:c.344T>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71918 |
| 239 | CD 115 (GCC>GAC) Ala to Asp | Hb Hradec Kralove (HK) | HBB:c.347C>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71921 |
| 1193 | CD 115 GCC>GTC [Ala>Val] | Hb Roma | HBB:c.347C>T | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71921 |
| 3228 | CD 116 CAT>-AT | N/A | HBB:c.349del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71923 |
| 240 | CD 116 (+TGAT) | N/A | HBB:c.349_350insTGAT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71924 |
| 1197 | CD 116 CAT>CCT [His>Pro] | Hb Miami | HBB:c.350A>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71924 |
| 2193 | CD 117 -C | N/A | HBB:c.354delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71928 |
| 241 | CD 118 (-T) > 156aa | Hb Sainte Seve | HBB:c.357delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71931 |
| 242 | CD 120 -A [156 aa] (CD 120 AAA>AA-) | Hb Filottrano | HBB:c.363delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
| 243 | CD 120/121 (+A) | N/A | HBB:c.363dupA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71937 |
| 244 | CD 121 GAA>TAA (120aa) | N/A | HBB:c.364G>T | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71938 |
| 245 | CD 123 (-A) >156aa | Hb Makabe | HBB:c.370delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
| 246 | CD 123-125 (-ACCCCACC) >135aa | Hb Khon Kaen | HBB:c.370_378delACCCCACCA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71944 |
| 3555 | CD 124 (+C) | N/A | HBB:c.374dup | β | Causative | β-thalassaemia, Haemolytic anaemia | NG_000007.3 | 71948 |
| 247 | CD 124 (-A) >156aa | N/A | HBB:c.375delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
| 2194 | CD 124/125 (+A) | N/A | HBB:c.375dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71949 |
| 248 | CD 125 (+CCA) | N/A | HBB:c.376_378dupCCA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71950 |
| 3227 | CD 125-126 (+CCAGT) | N/A | HBB:c.376_380dupCCAGT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71950 |
| 2195 | CD 125-127 (-CAGTGC) | N/A | HBB:c.377_382delCAGTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71951 |
| 249 | CD 125 (-A) >156aa | N/A | HBB:c.378delA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71952 |
| 3563 | CD 126 GTG>-TG | N/A | HBB:c.379delG | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71953 |
| 250 | CD 126 (-T) >156aa | Hb Vercelli | HBB:c.380delT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71954 |
| 1235 | CD 126 GTG>GGG [Val>Gly] (Hb Neapolis) | Hb Dhonburi | HBB:c.380T>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71954 |
| 255 | CD 127 CAG>TAG [Gln>STOP] | N/A | HBB:c.382C>T | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71956 |
| 253 | CD 127 (CAG>CCG) Gln to Pro | Hb Houston | HBB:c.383A>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
| 254 | CD 127 CAG>CGG [Gln>Arg] | Hb Dieppe | HBB:c.383A>G | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
| 256 | CD 127/128 -AGG [Glu-Ala>Pro] | Hb Gunma | HBB:c.383_385delAGG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71957 |
| 257 | CD 128/129 (-4, +5, -11 bp) >153aa | N/A | HBB:c.[385_388delinsCCACA;397_407delAAAGTGGTGGC] | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71959 |
| 1241 | CD 128 GCT>CCT | Hb Mont Saint Aignan | HBB:c.385G>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71959 |
| 1243 | CD 128 GCT>GAT [Ala>Asp] | Hb J-Guantanamo | HBB:c.386C>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71960 |
| 2196 | CD 130 TAT>TAA [Tyr>STOP] | N/A | HBB:c.393T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71967 |
| 258 | CD 131 (CAG>TAG) | N/A | HBB:c.394C>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71968 |
| 2197 | CD 131 (+A) | N/A | HBB:c.395dupA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71969 |
| 259 | CD 131/132 (+GCCT) | N/A | HBB:c.396_397insGCCT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
| 260 | CD 131-132 (-GA) >138aa | N/A | HBB:c.396_397delGA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
| 261 | CD 131-134 (-11bp) >134aa | N/A | HBB:c.396_406del | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71970 |
| 262 | CD 132 (AAA>TAA) | N/A | HBB:c.397A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71971 |
| 1257 | CD 132 AAA>CAA [Lys>Gln] | Hb K Woolwich | HBB:c.397A>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71971 |
| 263 | CD 134-137 (-12, +6 bp) Val-Ala-Gly-Val to Gly-Arg | N/A | HBB:c.404_413delinsGCAG | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71978 |
| 1264 | CD 134 GTG>GAG | Hb North Shore | HBB:c.404T>A | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71978 |
| 1266 | CD 135 GCT>GAT [Ala>Asp] | Hb Beckman | HBB:c.407C>A | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71981 |
| 3249 | CD 135 GCT>GC- | Hb Urumqi | HBB:c.408delT | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71982 |
| 264 | CD 137-139 (-TGGCTA) Val-Ala-Asn to Asp | Hb Stara Zagora | HBB:c.413_418delTGGCTA | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71987 |
| 1274 | CD 138 GCT>CCT [Ala>Pro] | Hb Brockton | HBB:c.415G>C | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71989 |
| 3361 | CD 138/139 (+T) | N/A | HBB:c.417dupT | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71991 |
| 1279 | CD 139 AAT>TAT [Asn>Tyr]; CD 138 (-GCT) [-Ala] (Hb Nykerk) | Hb Nijkerk | HBB:c.[418A>T;415_417delGCT] | β | Causative | β-chain variant, Haemolytic anaemia | NG_000007.3 | 71992 |
| 2282 | CD 139/140 +T [163 aa] | Hb Boston-Kuwait | HBB:c.420dupT | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71994 |
| 265 | CD 141 (-C) >156aa | Hb Florida | HBB:c.424delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 71998 |
| 3980 | CD 141 CTG>CCG [Leu>Pro] | Hb Yoshkar-Ola | HBB:c.425T>C | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia | NG_000007.3 | 71999 |
| 1290 | CD 142 (-CC) | Hb Uzes | HBB:c.429_430delCC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72003 |
| 2024 | CD 143 (-C) | Hb Montreal II | HBB:c.430delC | β | Causative | β-thalassaemia, β-chain variant, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72004 |
| 267 | 3'UTR +6 C>G (Terminal CD +6 C>G, CAP +1480, β nt 1480 C>G) | N/A | HBB:c.*6C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72024 |
| 2177 | 3'UTR +32 A>C (3'UTR +1506 (A>C), Terminal CD +32 A>C) | N/A | HBB:c.*32A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72050 |
| 268 | 3'UTR +47 C>G (Terminal CD +47 C>G) | N/A | HBB:c.*47C>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72065 |
| 269 | 3'UTR -13 bp [CAP +1567 to +1579] | N/A | HBB:c.*93_*105delATCTGGATTCTGC | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72111 |
| 270 | Poly A (A>C) AATAAA>CATAAA | N/A | HBB:c.*108A>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
| 271 | Poly A (A>G) AATAAA>GATAAA | N/A | HBB:c.*108A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72126 |
| 272 | Poly A (T>C) AATAAA>AACAAA | N/A | HBB:c.*110T>C | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
| 273 | Poly A (T>A) AATAAA>AAAAAA | N/A | HBB:c.*110T>A | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
| 277 | Poly A (-TA); (AATAAA>AAAA) | N/A | HBB:c.*110_*111delTA | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
| 278 | Poly A (-AATAA) (polyA (-TAAAA)) | N/A | HBB:c.*110_*114del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
| 4025 | Poly A (-T) AATAAA>AA-AAA | N/A | HBB:c.*110del | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72128 |
| 274 | Poly A (A>G) AATAAA>AATGAA | N/A | HBB:c.*111A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72129 |
| 275 | Poly A (A>G) AATAAA>AATAGA | N/A | HBB:c.*112A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
| 2198 | Poly A (A>T) AATAAA>AATATA | N/A | HBB:c.*112A>T | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72130 |
| 276 | Poly A (A>G) AATAAA>AATAAG | N/A | HBB:c.*113A>G | β | Causative | β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis | NG_000007.3 | 72131 |
| 2687 | rs3730070 | N/A | NG_042166.1:g.19032C>G | ADCY6 | Modifier | Haemolytic anaemia, RBC adhesion | NG_042166.1 | 19032 |
| 2782 | rs7203560 | N/A | NG_029669.1:g.9308A>C | NPRL3 | Modifier | Haemolytic anaemia, Bilirubin levels, Reticulocytopenia | NG_029669.1 | 9308 |
| 3541 | rs7938426 | N/A | NC_000011.10:g.5450602A>G | OR51B5 | Modifier | Haemolytic anaemia | N/A | 0 |
| 3542 | rs7948471 | N/A | NC_000011.10:g.5450516G>A | OR51B5 | Modifier | Haemolytic anaemia | N/A | 0 |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2025-12-17 15:22:02