IthaID: 3526
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs9760319 | HGVS Name: | NC_000004.12:g.137491375A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
AAGAAAATGTTTCACTCACATTTACA [A>G] AATCCTTAGAAAGTTTGAGACTACAA (Strand: +)
Comments: SNP associated with a higher white blood cell count in the Kore Association Resource (KARE) project of the Korean Genome Epidemiology Study (KoGES; n=8842). The association was replicated in healthy samples from the Cardio Vascular Disease Association Study (CAVAS) of KoGES (n=3667). SNP is found downstream of a non-coding RNA (LOC105377442) within the intergenic region between RPS23P2 and PCDH18.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Abnormal white blood cell count [HP:0011893] |
Location
| Chromosome: | 4 |
|---|---|
| Locus: | N/A |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | RPS23P2-PCDH18 |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Korean |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Kim YK, Oh JH, Kim YJ, Hwang MY, Moon S, Low SK, Takahashi A, Matsuda K, Kubo M, Lee J, Kim BJ, Influence of Genetic Variants in EGF and Other Genes on Hematological Traits in Korean Populations by a Genome-Wide Approach., Biomed Res Int , 2015(0), 914965, 2015 PubMed
Created on 2019-12-10 10:03:14,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.