IthaID: 3534
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs55890525 | HGVS Name: | NC_000010.11:g.70171015C>A |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CGCGATCTCGGCTCACTGCAACCTCCA [C>A] CTCCCGGATTCAAGCGATTCTCATACC (Strand: +)
Comments: SNP is located within 2KB 5' of SAR1A gene. SNP is associated with a higher percent of HbF with hydroxyurea treatment in African Americans with sickle cell disease acquired from the Sickle Cell Pulmonary Hypertension Screening Study (n=176). Note: Published SNP position 'chr10:71600777 (hg18)' is remapped on the GRCh38.p13 genome assembly.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F response to hydroxyurea |
Location
| Chromosome: | 10 |
|---|---|
| Locus: | NM_001142648.2 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | SAR1A |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African-American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Kumkhaek C, Taylor JG, Zhu J, Hoppe C, Kato GJ, Rodgers GP, Fetal haemoglobin response to hydroxycarbamide treatment and sar1a promoter polymorphisms in sickle cell anaemia., Br. J. Haematol. , 141(2), 254-9, 2008 PubMed
Created on 2019-12-12 12:18:21,
Last reviewed on 2019-12-12 15:38:19 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.